Skip to content

Instantly share code, notes, and snippets.

@radaniba
Created April 18, 2014 01:03
Show Gist options
  • Select an option

  • Save radaniba/11019717 to your computer and use it in GitHub Desktop.

Select an option

Save radaniba/11019717 to your computer and use it in GitHub Desktop.
Smith Waterman Implementation in Python
#!/Users/Rad/anaconda/bin/python
# (c) 2013 Ryan Boehning
'''A Python implementation of the Smith-Waterman algorithm for local alignment
of nucleotide sequences.
'''
import argparse
import os
import re
import sys
import unittest
# These scores are taken from Wikipedia.
# en.wikipedia.org/wiki/Smith%E2%80%93Waterman_algorithm
match = 2
mismatch = -1
gap = -1
seq1 = None
seq2 = None
def main():
try:
parse_cmd_line()
except ValueError as err:
print('error:', err)
return
# The scoring matrix contains an extra row and column for the gap (-), hence
# the +1 here.
rows = len(seq1) + 1
cols = len(seq2) + 1
# Initialize the scoring matrix.
score_matrix, start_pos = create_score_matrix(rows, cols)
# Traceback. Find the optimal path through the scoring matrix. This path
# corresponds to the optimal local sequence alignment.
seq1_aligned, seq2_aligned = traceback(score_matrix, start_pos)
assert len(seq1_aligned) == len(seq2_aligned), 'aligned strings are not the same size'
# Pretty print the results. The printing follows the format of BLAST results
# as closely as possible.
alignment_str, idents, gaps, mismatches = alignment_string(seq1_aligned, seq2_aligned)
alength = len(seq1_aligned)
print()
print(' Identities = {0}/{1} ({2:.1%}), Gaps = {3}/{4} ({5:.1%})'.format(idents,
alength, idents / alength, gaps, alength, gaps / alength))
print()
for i in range(0, alength, 60):
seq1_slice = seq1_aligned[i:i+60]
print('Query {0:<4} {1} {2:<4}'.format(i + 1, seq1_slice, i + len(seq1_slice)))
print(' {0}'.format(alignment_str[i:i+60]))
seq2_slice = seq2_aligned[i:i+60]
print('Sbjct {0:<4} {1} {2:<4}'.format(i + 1, seq2_slice, i + len(seq2_slice)))
print()
def parse_cmd_line():
'''Parse the command line arguments.
Create a help menu, take input from the command line, and validate the
input by ensuring it does not contain invalid characters (i.e. characters
that aren't the bases A, C, G, or T).
'''
seq1 = "ATAGACGACATACAGACAGCATACAGACAGCATACAGA"
seq2 = "TTTAGCATGCGCATATCAGCAATACAGACAGATACG"
def create_score_matrix(rows, cols):
'''Create a matrix of scores representing trial alignments of the two sequences.
Sequence alignment can be treated as a graph search problem. This function
creates a graph (2D matrix) of scores, which are based on trial alignments
of different base pairs. The path with the highest cummulative score is the
best alignment.
'''
score_matrix = [[0 for col in range(cols)] for row in range(rows)]
# Fill the scoring matrix.
max_score = 0
max_pos = None # The row and columbn of the highest score in matrix.
for i in range(1, rows):
for j in range(1, cols):
score = calc_score(score_matrix, i, j)
if score > max_score:
max_score = score
max_pos = (i, j)
score_matrix[i][j] = score
assert max_pos is not None, 'the x, y position with the highest score was not found'
return score_matrix, max_pos
def calc_score(matrix, x, y):
'''Calculate score for a given x, y position in the scoring matrix.
The score is based on the up, left, and upper-left neighbors.
'''
similarity = match if seq1[x - 1] == seq2[y - 1] else mismatch
diag_score = matrix[x - 1][y - 1] + similarity
up_score = matrix[x - 1][y] + gap
left_score = matrix[x][y - 1] + gap
return max(0, diag_score, up_score, left_score)
def traceback(score_matrix, start_pos):
'''Find the optimal path through the matrix.
This function traces a path from the bottom-right to the top-left corner of
the scoring matrix. Each move corresponds to a match, mismatch, or gap in one
or both of the sequences being aligned. Moves are determined by the score of
three adjacent squares: the upper square, the left square, and the diagonal
upper-left square.
WHAT EACH MOVE REPRESENTS
diagonal: match/mismatch
up: gap in sequence 1
left: gap in sequence 2
'''
END, DIAG, UP, LEFT = range(4)
aligned_seq1 = []
aligned_seq2 = []
x, y = start_pos
move = next_move(score_matrix, x, y)
while move != END:
if move == DIAG:
aligned_seq1.append(seq1[x - 1])
aligned_seq2.append(seq2[y - 1])
x -= 1
y -= 1
elif move == UP:
aligned_seq1.append(seq1[x - 1])
aligned_seq2.append('-')
x -= 1
else:
aligned_seq1.append('-')
aligned_seq2.append(seq2[y - 1])
y -= 1
move = next_move(score_matrix, x, y)
aligned_seq1.append(seq1[x - 1])
aligned_seq2.append(seq1[y - 1])
return ''.join(reversed(aligned_seq1)), ''.join(reversed(aligned_seq2))
def next_move(score_matrix, x, y):
diag = score_matrix[x - 1][y - 1]
up = score_matrix[x - 1][y]
left = score_matrix[x][y - 1]
if diag >= up and diag >= left: # Tie goes to the DIAG move.
return 1 if diag != 0 else 0 # 1 signals a DIAG move. 0 signals the end.
elif up > diag and up >= left: # Tie goes to UP move.
return 2 if up != 0 else 0 # UP move or end.
elif left > diag and left > up:
return 3 if left != 0 else 0 # LEFT move or end.
else:
# Execution should not reach here.
raise ValueError('invalid move during traceback')
def alignment_string(aligned_seq1, aligned_seq2):
'''Construct a special string showing identities, gaps, and mismatches.
This string is printed between the two aligned sequences and shows the
identities (|), gaps (-), and mismatches (:). As the string is constructed,
it also counts number of identities, gaps, and mismatches and returns the
counts along with the alignment string.
AAGGATGCCTCAAATCGATCT-TTTTCTTGG-
::||::::::||:|::::::: |: :||:| <-- alignment string
CTGGTACTTGCAGAGAAGGGGGTA--ATTTGG
'''
# Build the string as a list of characters to avoid costly string
# concatenation.
idents, gaps, mismatches = 0, 0, 0
alignment_string = []
for base1, base2 in zip(aligned_seq1, aligned_seq2):
if base1 == base2:
alignment_string.append('|')
idents += 1
elif '-' in (base1, base2):
alignment_string.append(' ')
gaps += 1
else:
alignment_string.append(':')
mismatches += 1
return ''.join(alignment_string), idents, gaps, mismatches
def print_matrix(matrix):
'''Print the scoring matrix.
ex:
0 0 0 0 0 0
0 2 1 2 1 2
0 1 1 1 1 1
0 0 3 2 3 2
0 2 2 5 4 5
0 1 4 4 7 6
'''
for row in matrix:
for col in row:
print('{0:>4}'.format(col))
print()
class ScoreMatrixTest(unittest.TestCase):
'''Compare the matrix produced by create_score_matrix() with a known matrix.'''
def test_matrix(self):
# From Wikipedia (en.wikipedia.org/wiki/Smith%E2%80%93Waterman_algorithm)
# - A C A C A C T A
known_matrix = [[0, 0, 0, 0, 0, 0, 0, 0, 0], # -
[0, 2, 1, 2, 1, 2, 1, 0, 2], # A
[0, 1, 1, 1, 1, 1, 1, 0, 1], # G
[0, 0, 3, 2, 3, 2, 3, 2, 1], # C
[0, 2, 2, 5, 4, 5, 4, 3, 4], # A
[0, 1, 4, 4, 7, 6, 7, 6, 5], # C
[0, 2, 3, 6, 6, 9, 8, 7, 8], # A
[0, 1, 4, 5, 8, 8, 11, 10, 9], # C
[0, 2, 3, 6, 7, 10, 10, 10, 12]] # A
global seq1, seq2
seq1 = 'AGCACACA'
seq2 = 'ACACACTA'
rows = len(seq1) + 1
cols = len(seq2) + 1
matrix_to_test, max_pos = create_score_matrix(rows, cols)
self.assertEqual(known_matrix, matrix_to_test)
if __name__ == '__main__':
sys.exit(main())
@mehmetalixk
Copy link

Local Alignment has multiple occurences

@shrividhatri
Copy link

Traceback (most recent call last): File "sw.py", line 241, in sys.exit(main()) File "sw.py", line 35, in main rows = len(seq1) + 1 TypeError: object of type 'NoneType' has no len()

You can replace the None with ur input sequence, and it will work properly

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment