| #!/bin/bash | |
| # Ollama Model Export Script | |
| # Usage: bash ollama-export.sh vicuna:7b | |
| # SPDX-License-Identifier: MIT (https://ncurl.xyz/s/o_o6DVqIR) | |
| # https://gist.github.com/supersonictw/f6cf5e599377132fe5e180b3d495c553 | |
| # Interrupt if any error occurred | |
| set -e | |
| # Declare |
This guide will show you how to install conda and then use it to install nextflow and singularity for executing popular bioinformatics workflows. Unfortunately, singularity is not available on Windows or macOS. So, this guide will only target Linux environments. If you have to use Windows 10, then try WSL2. If you have to use macOS, then try a Virtual Machine.
Download the Miniconda3 installer for Linux environments:
curl -L https://repo.anaconda.com/miniconda/Miniconda3-latest-Linux-x86_64.sh -o miniconda.shInstall into a folder named miniconda3 under your home directory, and delete the installer:
bash miniconda.sh -bup $HOME/miniconda3 && rm -f miniconda.sh| $ 1 0.000005 0.2954511527092107 50 5 50 | |
| 402 400 496 560 496 1 0\s0\s40\s-9\s0\s0\s0.5 0\s0\s40\s9\s0\s0\s0.5 0\s1\s-12.107891388002887\s0.49020072449645724\s100 0\s1\s-0.49020072449645724\s0.4899458951514504\s100 0\s1\s0\s0.4899458951514504\s100 0\s1\s-3.4423968860970877\s0.48994335934397704\s100 0\s1\s-8.969060690957324\s-4.088038007650795\s100 0\s-1\s0.48993828812503004\s-0.4896834587831105\s100 0\s-1\s0\s-0.4896834587831105\s100 0\s-1\s16.04076664862162\s-0.48993828812503004\s100 0\s-1\s0.0070150138786200245\s-0.02392429516405592\s100 0\s-1\s0\s-0.02392429516405592\s100 0\s-1\s9.993078392331174\s-0.0070150138786200245\s100 0\s1\s0\s0.48967838756419013\s100 0\s1\s-0.4899332169060475\s0.48967838756419013\s100 0\s1\s-6.996370694155912\s0.4899332169060475\s100 0\s1\s0\s-13.57798136396477\s100 0\s1\s0\s-8.999999996969999\s100 | |
| w 560 496 576 496 0 | |
| w 576 496 592 496 0 | |
| g 320 464 320 496 0 | |
| w 400 496 384 496 0 | |
| r 384 496 384 368 0 15000 | |
| r 544 368 544 432 0 1000000 | |
| w 544 432 544 464 1 | |
| R 544 368 544 336 0 0 40 9 0 0 0.5 |
| import sys, os, json | |
| import datetime | |
| sys.path.append(os.path.expanduser('~/google-cloud-sdk/platform/google_appengine/')) | |
| from google.appengine.api.files import records | |
| from google.appengine.datastore import entity_pb | |
| from google.appengine.api import datastore | |
| def myconverter(o): | |
| if isinstance(o, datetime.datetime): |
| #!/bin/bash | |
| set -e | |
| function cleanup { | |
| echo "" | |
| echo "Cleaning up processes" | |
| kill -SIGINT -$GID | |
| } | |
| trap cleanup EXIT | |
| if [ "$1" ]; then |
| #!/bin/bash | |
| if [ "$#" -ne 1 ]; then | |
| echo -e "Incorrect number of parameters! Usage:\n index-gtf.sh <file.gtf(.gz)>" >&2 | |
| exit 1 | |
| fi | |
| gtf="$1" | |
| if [[ $gtf =~ \.gz$ ]]; then |
| Bootstrap: localimage | |
| From: /home/vanessa/.singularity/shub/deepvariant-docker-deepvariant:0.5.0.simg | |
| # sregistry get gcr.io/deepvariant-docker/deepvariant:0.5.0 | |
| # sudo singularity build deepvariant Singularity | |
| %environment | |
| PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin | |
| DV_GPU_BUILD=0 | |
| export PATH DV_GPU_BUILD |
So, you've created a Python app (be it a graphical user interface with Qt or the like, or a simple command line interface). Great! But how are others going to use it? Python applications often have dependencies (e.g. from third-party modules), and they also need a Python interpreter to run them. For a developer, installing all the necessary bits and bobs to make things work is okay, but that's unacceptable for a normal user - they just want to download the thing and run it.
Below are simple instructions to publish your app on the three main operating systems: Windows, macOS and Linux.
| >Illumina Single End Apapter 1 | |
| ACACTCTTTCCCTACACGACGCTGTTCCATCT | |
| >Illumina Single End Apapter 2 | |
| CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT | |
| >Illumina Single End PCR Primer 1 | |
| AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT | |
| >Illumina Single End PCR Primer 2 | |
| CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT | |
| >Illumina Single End Sequencing Primer | |
| ACACTCTTTCCCTACACGACGCTCTTCCGATCT |