Skip to content

Instantly share code, notes, and snippets.

@elfefe
Created December 6, 2022 16:38
Show Gist options
  • Select an option

  • Save elfefe/252c384658857d839032c3d9d6312b80 to your computer and use it in GitHub Desktop.

Select an option

Save elfefe/252c384658857d839032c3d9d6312b80 to your computer and use it in GitHub Desktop.
Little chat with an AI about Genetic
<html><head>
<meta http-equiv="content-type" content="text/html; charset=UTF-8"></head><body><div class="flex-1 overflow-hidden"><div class="react-scroll-to-bottom--css-nghnr-79elbk h-full dark:bg-gray-800"><div class="react-scroll-to-bottom--css-nghnr-1n7m0yu"><div class="flex flex-col items-center text-sm h-full dark:bg-gray-800"><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group dark:bg-gray-800"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative flex"><span style="box-sizing: border-box; display: inline-block; overflow: hidden; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; position: relative; max-width: 100%;"><span style="box-sizing: border-box; display: block; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; max-width: 100%;"><img alt="" aria-hidden="true" src="data:image/svg+xml,%3csvg%20xmlns=%27http://www.w3.org/2000/svg%27%20version=%271.1%27%20width=%2730%27%20height=%2730%27/%3e" style="display: block; max-width: 100%; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px;"></span><img alt="Félix" src="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75" decoding="async" data-nimg="intrinsic" class="rounded-sm" srcset="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=32&amp;q=75 1x, /_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75 2x" style="position: absolute; inset: 0px; box-sizing: border-box; padding: 0px; border: none; margin: auto; display: block; width: 0px; height: 0px; min-width: 100%; max-width: 100%; min-height: 100%; max-height: 100%;"></span></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4">What was before planck era ?</div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M11 4H4a2 2 0 0 0-2 2v14a2 2 0 0 0 2 2h14a2 2 0 0 0 2-2v-7"></path><path d="M18.5 2.5a2.121 2.121 0 0 1 3 3L12 15l-4 1 1-4 9.5-9.5z"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group bg-gray-50 dark:bg-[#444654]"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative h-[30px] w-[30px] p-1 rounded-sm text-white flex items-center justify-center" style="background-color: rgb(16, 163, 127);"><svg width="41" height="41" viewBox="0 0 41 41" fill="none" xmlns="http://www.w3.org/2000/svg" stroke-width="1.5" class="w-6 h-6"><path d="M37.5324 16.8707C37.9808 15.5241 38.1363 14.0974 37.9886 12.6859C37.8409 11.2744 37.3934 9.91076 36.676 8.68622C35.6126 6.83404 33.9882 5.3676 32.0373 4.4985C30.0864 3.62941 27.9098 3.40259 25.8215 3.85078C24.8796 2.7893 23.7219 1.94125 22.4257 1.36341C21.1295 0.785575 19.7249 0.491269 18.3058 0.500197C16.1708 0.495044 14.0893 1.16803 12.3614 2.42214C10.6335 3.67624 9.34853 5.44666 8.6917 7.47815C7.30085 7.76286 5.98686 8.3414 4.8377 9.17505C3.68854 10.0087 2.73073 11.0782 2.02839 12.312C0.956464 14.1591 0.498905 16.2988 0.721698 18.4228C0.944492 20.5467 1.83612 22.5449 3.268 24.1293C2.81966 25.4759 2.66413 26.9026 2.81182 28.3141C2.95951 29.7256 3.40701 31.0892 4.12437 32.3138C5.18791 34.1659 6.8123 35.6322 8.76321 36.5013C10.7141 37.3704 12.8907 37.5973 14.9789 37.1492C15.9208 38.2107 17.0786 39.0587 18.3747 39.6366C19.6709 40.2144 21.0755 40.5087 22.4946 40.4998C24.6307 40.5054 26.7133 39.8321 28.4418 38.5772C30.1704 37.3223 31.4556 35.5506 32.1119 33.5179C33.5027 33.2332 34.8167 32.6547 35.9659 31.821C37.115 30.9874 38.0728 29.9178 38.7752 28.684C39.8458 26.8371 40.3023 24.6979 40.0789 22.5748C39.8556 20.4517 38.9639 18.4544 37.5324 16.8707ZM22.4978 37.8849C20.7443 37.8874 19.0459 37.2733 17.6994 36.1501C17.7601 36.117 17.8666 36.0586 17.936 36.0161L25.9004 31.4156C26.1003 31.3019 26.2663 31.137 26.3813 30.9378C26.4964 30.7386 26.5563 30.5124 26.5549 30.2825V19.0542L29.9213 20.998C29.9389 21.0068 29.9541 21.0198 29.9656 21.0359C29.977 21.052 29.9842 21.0707 29.9867 21.0902V30.3889C29.9842 32.375 29.1946 34.2791 27.7909 35.6841C26.3872 37.0892 24.4838 37.8806 22.4978 37.8849ZM6.39227 31.0064C5.51397 29.4888 5.19742 27.7107 5.49804 25.9832C5.55718 26.0187 5.66048 26.0818 5.73461 26.1244L13.699 30.7248C13.8975 30.8408 14.1233 30.902 14.3532 30.902C14.583 30.902 14.8088 30.8408 15.0073 30.7248L24.731 25.1103V28.9979C24.7321 29.0177 24.7283 29.0376 24.7199 29.0556C24.7115 29.0736 24.6988 29.0893 24.6829 29.1012L16.6317 33.7497C14.9096 34.7416 12.8643 35.0097 10.9447 34.4954C9.02506 33.9811 7.38785 32.7263 6.39227 31.0064ZM4.29707 13.6194C5.17156 12.0998 6.55279 10.9364 8.19885 10.3327C8.19885 10.4013 8.19491 10.5228 8.19491 10.6071V19.808C8.19351 20.0378 8.25334 20.2638 8.36823 20.4629C8.48312 20.6619 8.64893 20.8267 8.84863 20.9404L18.5723 26.5542L15.206 28.4979C15.1894 28.5089 15.1703 28.5155 15.1505 28.5173C15.1307 28.5191 15.1107 28.516 15.0924 28.5082L7.04046 23.8557C5.32135 22.8601 4.06716 21.2235 3.55289 19.3046C3.03862 17.3858 3.30624 15.3413 4.29707 13.6194ZM31.955 20.0556L22.2312 14.4411L25.5976 12.4981C25.6142 12.4872 25.6333 12.4805 25.6531 12.4787C25.6729 12.4769 25.6928 12.4801 25.7111 12.4879L33.7631 17.1364C34.9967 17.849 36.0017 18.8982 36.6606 20.1613C37.3194 21.4244 37.6047 22.849 37.4832 24.2684C37.3617 25.6878 36.8382 27.0432 35.9743 28.1759C35.1103 29.3086 33.9415 30.1717 32.6047 30.6641C32.6047 30.5947 32.6047 30.4733 32.6047 30.3889V21.188C32.6066 20.9586 32.5474 20.7328 32.4332 20.5338C32.319 20.3348 32.154 20.1698 31.955 20.0556ZM35.3055 15.0128C35.2464 14.9765 35.1431 14.9142 35.069 14.8717L27.1045 10.2712C26.906 10.1554 26.6803 10.0943 26.4504 10.0943C26.2206 10.0943 25.9948 10.1554 25.7963 10.2712L16.0726 15.8858V11.9982C16.0715 11.9783 16.0753 11.9585 16.0837 11.9405C16.0921 11.9225 16.1048 11.9068 16.1207 11.8949L24.1719 7.25025C25.4053 6.53903 26.8158 6.19376 28.2383 6.25482C29.6608 6.31589 31.0364 6.78077 32.2044 7.59508C33.3723 8.40939 34.2842 9.53945 34.8334 10.8531C35.3826 12.1667 35.5464 13.6095 35.3055 15.0128ZM14.2424 21.9419L10.8752 19.9981C10.8576 19.9893 10.8423 19.9763 10.8309 19.9602C10.8195 19.9441 10.8122 19.9254 10.8098 19.9058V10.6071C10.8107 9.18295 11.2173 7.78848 11.9819 6.58696C12.7466 5.38544 13.8377 4.42659 15.1275 3.82264C16.4173 3.21869 17.8524 2.99464 19.2649 3.1767C20.6775 3.35876 22.0089 3.93941 23.1034 4.85067C23.0427 4.88379 22.937 4.94215 22.8668 4.98473L14.9024 9.58517C14.7025 9.69878 14.5366 9.86356 14.4215 10.0626C14.3065 10.2616 14.2466 10.4877 14.2479 10.7175L14.2424 21.9419ZM16.071 17.9991L20.4018 15.4978L24.7325 17.9975V22.9985L20.4018 25.4983L16.071 22.9985V17.9991Z" fill="currentColor"></path></svg></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4"><div class="request-:R2d6:-0 markdown prose dark:prose-invert break-words dark"><p>The
Planck era is considered the earliest moment in the history of the
universe, so there was nothing before it. The Planck era is named after
the German physicist Max Planck, who made important contributions to the
study of quantum mechanics. It is believed that the universe began with
a singularity, which is a point of infinite density and temperature.
The Planck era is thought to have lasted for a very short time, around
10^-43 seconds. This is the time it took for the universe to expand and
cool enough for the fundamental forces of nature to become distinct from
one another.</p></div></div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M14 9V5a3 3 0 0 0-3-3l-4 9v11h11.28a2 2 0 0 0 2-1.7l1.38-9a2 2 0 0 0-2-2.3zM7 22H4a2 2 0 0 1-2-2v-7a2 2 0 0 1 2-2h3"></path></svg></button><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M10 15v4a3 3 0 0 0 3 3l4-9V2H5.72a2 2 0 0 0-2 1.7l-1.38 9a2 2 0 0 0 2 2.3zm7-13h2.67A2.31 2.31 0 0 1 22 4v7a2.31 2.31 0 0 1-2.33 2H17"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group dark:bg-gray-800"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative flex"><span style="box-sizing: border-box; display: inline-block; overflow: hidden; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; position: relative; max-width: 100%;"><span style="box-sizing: border-box; display: block; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; max-width: 100%;"><img alt="" aria-hidden="true" src="data:image/svg+xml,%3csvg%20xmlns=%27http://www.w3.org/2000/svg%27%20version=%271.1%27%20width=%2730%27%20height=%2730%27/%3e" style="display: block; max-width: 100%; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px;"></span><img alt="Félix" srcset="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=32&amp;q=75 1x, /_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75 2x" src="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75" decoding="async" data-nimg="intrinsic" class="rounded-sm" style="position: absolute; inset: 0px; box-sizing: border-box; padding: 0px; border: none; margin: auto; display: block; width: 0px; height: 0px; min-width: 100%; max-width: 100%; min-height: 100%; max-height: 100%;"></span></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4">Is it possible to engineer life forms in a very precise way ?</div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M11 4H4a2 2 0 0 0-2 2v14a2 2 0 0 0 2 2h14a2 2 0 0 0 2-2v-7"></path><path d="M18.5 2.5a2.121 2.121 0 0 1 3 3L12 15l-4 1 1-4 9.5-9.5z"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group bg-gray-50 dark:bg-[#444654]"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative h-[30px] w-[30px] p-1 rounded-sm text-white flex items-center justify-center" style="background-color: rgb(16, 163, 127);"><svg width="41" height="41" viewBox="0 0 41 41" fill="none" xmlns="http://www.w3.org/2000/svg" stroke-width="1.5" class="w-6 h-6"><path d="M37.5324 16.8707C37.9808 15.5241 38.1363 14.0974 37.9886 12.6859C37.8409 11.2744 37.3934 9.91076 36.676 8.68622C35.6126 6.83404 33.9882 5.3676 32.0373 4.4985C30.0864 3.62941 27.9098 3.40259 25.8215 3.85078C24.8796 2.7893 23.7219 1.94125 22.4257 1.36341C21.1295 0.785575 19.7249 0.491269 18.3058 0.500197C16.1708 0.495044 14.0893 1.16803 12.3614 2.42214C10.6335 3.67624 9.34853 5.44666 8.6917 7.47815C7.30085 7.76286 5.98686 8.3414 4.8377 9.17505C3.68854 10.0087 2.73073 11.0782 2.02839 12.312C0.956464 14.1591 0.498905 16.2988 0.721698 18.4228C0.944492 20.5467 1.83612 22.5449 3.268 24.1293C2.81966 25.4759 2.66413 26.9026 2.81182 28.3141C2.95951 29.7256 3.40701 31.0892 4.12437 32.3138C5.18791 34.1659 6.8123 35.6322 8.76321 36.5013C10.7141 37.3704 12.8907 37.5973 14.9789 37.1492C15.9208 38.2107 17.0786 39.0587 18.3747 39.6366C19.6709 40.2144 21.0755 40.5087 22.4946 40.4998C24.6307 40.5054 26.7133 39.8321 28.4418 38.5772C30.1704 37.3223 31.4556 35.5506 32.1119 33.5179C33.5027 33.2332 34.8167 32.6547 35.9659 31.821C37.115 30.9874 38.0728 29.9178 38.7752 28.684C39.8458 26.8371 40.3023 24.6979 40.0789 22.5748C39.8556 20.4517 38.9639 18.4544 37.5324 16.8707ZM22.4978 37.8849C20.7443 37.8874 19.0459 37.2733 17.6994 36.1501C17.7601 36.117 17.8666 36.0586 17.936 36.0161L25.9004 31.4156C26.1003 31.3019 26.2663 31.137 26.3813 30.9378C26.4964 30.7386 26.5563 30.5124 26.5549 30.2825V19.0542L29.9213 20.998C29.9389 21.0068 29.9541 21.0198 29.9656 21.0359C29.977 21.052 29.9842 21.0707 29.9867 21.0902V30.3889C29.9842 32.375 29.1946 34.2791 27.7909 35.6841C26.3872 37.0892 24.4838 37.8806 22.4978 37.8849ZM6.39227 31.0064C5.51397 29.4888 5.19742 27.7107 5.49804 25.9832C5.55718 26.0187 5.66048 26.0818 5.73461 26.1244L13.699 30.7248C13.8975 30.8408 14.1233 30.902 14.3532 30.902C14.583 30.902 14.8088 30.8408 15.0073 30.7248L24.731 25.1103V28.9979C24.7321 29.0177 24.7283 29.0376 24.7199 29.0556C24.7115 29.0736 24.6988 29.0893 24.6829 29.1012L16.6317 33.7497C14.9096 34.7416 12.8643 35.0097 10.9447 34.4954C9.02506 33.9811 7.38785 32.7263 6.39227 31.0064ZM4.29707 13.6194C5.17156 12.0998 6.55279 10.9364 8.19885 10.3327C8.19885 10.4013 8.19491 10.5228 8.19491 10.6071V19.808C8.19351 20.0378 8.25334 20.2638 8.36823 20.4629C8.48312 20.6619 8.64893 20.8267 8.84863 20.9404L18.5723 26.5542L15.206 28.4979C15.1894 28.5089 15.1703 28.5155 15.1505 28.5173C15.1307 28.5191 15.1107 28.516 15.0924 28.5082L7.04046 23.8557C5.32135 22.8601 4.06716 21.2235 3.55289 19.3046C3.03862 17.3858 3.30624 15.3413 4.29707 13.6194ZM31.955 20.0556L22.2312 14.4411L25.5976 12.4981C25.6142 12.4872 25.6333 12.4805 25.6531 12.4787C25.6729 12.4769 25.6928 12.4801 25.7111 12.4879L33.7631 17.1364C34.9967 17.849 36.0017 18.8982 36.6606 20.1613C37.3194 21.4244 37.6047 22.849 37.4832 24.2684C37.3617 25.6878 36.8382 27.0432 35.9743 28.1759C35.1103 29.3086 33.9415 30.1717 32.6047 30.6641C32.6047 30.5947 32.6047 30.4733 32.6047 30.3889V21.188C32.6066 20.9586 32.5474 20.7328 32.4332 20.5338C32.319 20.3348 32.154 20.1698 31.955 20.0556ZM35.3055 15.0128C35.2464 14.9765 35.1431 14.9142 35.069 14.8717L27.1045 10.2712C26.906 10.1554 26.6803 10.0943 26.4504 10.0943C26.2206 10.0943 25.9948 10.1554 25.7963 10.2712L16.0726 15.8858V11.9982C16.0715 11.9783 16.0753 11.9585 16.0837 11.9405C16.0921 11.9225 16.1048 11.9068 16.1207 11.8949L24.1719 7.25025C25.4053 6.53903 26.8158 6.19376 28.2383 6.25482C29.6608 6.31589 31.0364 6.78077 32.2044 7.59508C33.3723 8.40939 34.2842 9.53945 34.8334 10.8531C35.3826 12.1667 35.5464 13.6095 35.3055 15.0128ZM14.2424 21.9419L10.8752 19.9981C10.8576 19.9893 10.8423 19.9763 10.8309 19.9602C10.8195 19.9441 10.8122 19.9254 10.8098 19.9058V10.6071C10.8107 9.18295 11.2173 7.78848 11.9819 6.58696C12.7466 5.38544 13.8377 4.42659 15.1275 3.82264C16.4173 3.21869 17.8524 2.99464 19.2649 3.1767C20.6775 3.35876 22.0089 3.93941 23.1034 4.85067C23.0427 4.88379 22.937 4.94215 22.8668 4.98473L14.9024 9.58517C14.7025 9.69878 14.5366 9.86356 14.4215 10.0626C14.3065 10.2616 14.2466 10.4877 14.2479 10.7175L14.2424 21.9419ZM16.071 17.9991L20.4018 15.4978L24.7325 17.9975V22.9985L20.4018 25.4983L16.071 22.9985V17.9991Z" fill="currentColor"></path></svg></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4"><div class="request-:R2d6:-1 markdown prose dark:prose-invert break-words dark"><p>It
is currently not possible to engineer life forms in a very precise way.
While scientists have made some progress in understanding the
fundamental processes of life and have developed techniques for
modifying and manipulating living organisms, creating entirely new life
forms from scratch is still beyond our current capabilities. This is a
very complex and difficult task, as living organisms are incredibly
complex and involve many different interacting systems and processes.
Additionally, creating new life forms raises ethical concerns and would
require extensive testing and regulation to ensure safety.</p></div></div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M14 9V5a3 3 0 0 0-3-3l-4 9v11h11.28a2 2 0 0 0 2-1.7l1.38-9a2 2 0 0 0-2-2.3zM7 22H4a2 2 0 0 1-2-2v-7a2 2 0 0 1 2-2h3"></path></svg></button><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M10 15v4a3 3 0 0 0 3 3l4-9V2H5.72a2 2 0 0 0-2 1.7l-1.38 9a2 2 0 0 0 2 2.3zm7-13h2.67A2.31 2.31 0 0 1 22 4v7a2.31 2.31 0 0 1-2.33 2H17"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group dark:bg-gray-800"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative flex"><span style="box-sizing: border-box; display: inline-block; overflow: hidden; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; position: relative; max-width: 100%;"><span style="box-sizing: border-box; display: block; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; max-width: 100%;"><img alt="" aria-hidden="true" src="data:image/svg+xml,%3csvg%20xmlns=%27http://www.w3.org/2000/svg%27%20version=%271.1%27%20width=%2730%27%20height=%2730%27/%3e" style="display: block; max-width: 100%; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px;"></span><img alt="Félix" srcset="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=32&amp;q=75 1x, /_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75 2x" src="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75" decoding="async" data-nimg="intrinsic" class="rounded-sm" style="position: absolute; inset: 0px; box-sizing: border-box; padding: 0px; border: none; margin: auto; display: block; width: 0px; height: 0px; min-width: 100%; max-width: 100%; min-height: 100%; max-height: 100%;"></span></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4">Generate a code that can read dna and explain it's sequence functions</div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M11 4H4a2 2 0 0 0-2 2v14a2 2 0 0 0 2 2h14a2 2 0 0 0 2-2v-7"></path><path d="M18.5 2.5a2.121 2.121 0 0 1 3 3L12 15l-4 1 1-4 9.5-9.5z"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group bg-gray-50 dark:bg-[#444654]"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative h-[30px] w-[30px] p-1 rounded-sm text-white flex items-center justify-center" style="background-color: rgb(16, 163, 127);"><svg width="41" height="41" viewBox="0 0 41 41" fill="none" xmlns="http://www.w3.org/2000/svg" stroke-width="1.5" class="w-6 h-6"><path d="M37.5324 16.8707C37.9808 15.5241 38.1363 14.0974 37.9886 12.6859C37.8409 11.2744 37.3934 9.91076 36.676 8.68622C35.6126 6.83404 33.9882 5.3676 32.0373 4.4985C30.0864 3.62941 27.9098 3.40259 25.8215 3.85078C24.8796 2.7893 23.7219 1.94125 22.4257 1.36341C21.1295 0.785575 19.7249 0.491269 18.3058 0.500197C16.1708 0.495044 14.0893 1.16803 12.3614 2.42214C10.6335 3.67624 9.34853 5.44666 8.6917 7.47815C7.30085 7.76286 5.98686 8.3414 4.8377 9.17505C3.68854 10.0087 2.73073 11.0782 2.02839 12.312C0.956464 14.1591 0.498905 16.2988 0.721698 18.4228C0.944492 20.5467 1.83612 22.5449 3.268 24.1293C2.81966 25.4759 2.66413 26.9026 2.81182 28.3141C2.95951 29.7256 3.40701 31.0892 4.12437 32.3138C5.18791 34.1659 6.8123 35.6322 8.76321 36.5013C10.7141 37.3704 12.8907 37.5973 14.9789 37.1492C15.9208 38.2107 17.0786 39.0587 18.3747 39.6366C19.6709 40.2144 21.0755 40.5087 22.4946 40.4998C24.6307 40.5054 26.7133 39.8321 28.4418 38.5772C30.1704 37.3223 31.4556 35.5506 32.1119 33.5179C33.5027 33.2332 34.8167 32.6547 35.9659 31.821C37.115 30.9874 38.0728 29.9178 38.7752 28.684C39.8458 26.8371 40.3023 24.6979 40.0789 22.5748C39.8556 20.4517 38.9639 18.4544 37.5324 16.8707ZM22.4978 37.8849C20.7443 37.8874 19.0459 37.2733 17.6994 36.1501C17.7601 36.117 17.8666 36.0586 17.936 36.0161L25.9004 31.4156C26.1003 31.3019 26.2663 31.137 26.3813 30.9378C26.4964 30.7386 26.5563 30.5124 26.5549 30.2825V19.0542L29.9213 20.998C29.9389 21.0068 29.9541 21.0198 29.9656 21.0359C29.977 21.052 29.9842 21.0707 29.9867 21.0902V30.3889C29.9842 32.375 29.1946 34.2791 27.7909 35.6841C26.3872 37.0892 24.4838 37.8806 22.4978 37.8849ZM6.39227 31.0064C5.51397 29.4888 5.19742 27.7107 5.49804 25.9832C5.55718 26.0187 5.66048 26.0818 5.73461 26.1244L13.699 30.7248C13.8975 30.8408 14.1233 30.902 14.3532 30.902C14.583 30.902 14.8088 30.8408 15.0073 30.7248L24.731 25.1103V28.9979C24.7321 29.0177 24.7283 29.0376 24.7199 29.0556C24.7115 29.0736 24.6988 29.0893 24.6829 29.1012L16.6317 33.7497C14.9096 34.7416 12.8643 35.0097 10.9447 34.4954C9.02506 33.9811 7.38785 32.7263 6.39227 31.0064ZM4.29707 13.6194C5.17156 12.0998 6.55279 10.9364 8.19885 10.3327C8.19885 10.4013 8.19491 10.5228 8.19491 10.6071V19.808C8.19351 20.0378 8.25334 20.2638 8.36823 20.4629C8.48312 20.6619 8.64893 20.8267 8.84863 20.9404L18.5723 26.5542L15.206 28.4979C15.1894 28.5089 15.1703 28.5155 15.1505 28.5173C15.1307 28.5191 15.1107 28.516 15.0924 28.5082L7.04046 23.8557C5.32135 22.8601 4.06716 21.2235 3.55289 19.3046C3.03862 17.3858 3.30624 15.3413 4.29707 13.6194ZM31.955 20.0556L22.2312 14.4411L25.5976 12.4981C25.6142 12.4872 25.6333 12.4805 25.6531 12.4787C25.6729 12.4769 25.6928 12.4801 25.7111 12.4879L33.7631 17.1364C34.9967 17.849 36.0017 18.8982 36.6606 20.1613C37.3194 21.4244 37.6047 22.849 37.4832 24.2684C37.3617 25.6878 36.8382 27.0432 35.9743 28.1759C35.1103 29.3086 33.9415 30.1717 32.6047 30.6641C32.6047 30.5947 32.6047 30.4733 32.6047 30.3889V21.188C32.6066 20.9586 32.5474 20.7328 32.4332 20.5338C32.319 20.3348 32.154 20.1698 31.955 20.0556ZM35.3055 15.0128C35.2464 14.9765 35.1431 14.9142 35.069 14.8717L27.1045 10.2712C26.906 10.1554 26.6803 10.0943 26.4504 10.0943C26.2206 10.0943 25.9948 10.1554 25.7963 10.2712L16.0726 15.8858V11.9982C16.0715 11.9783 16.0753 11.9585 16.0837 11.9405C16.0921 11.9225 16.1048 11.9068 16.1207 11.8949L24.1719 7.25025C25.4053 6.53903 26.8158 6.19376 28.2383 6.25482C29.6608 6.31589 31.0364 6.78077 32.2044 7.59508C33.3723 8.40939 34.2842 9.53945 34.8334 10.8531C35.3826 12.1667 35.5464 13.6095 35.3055 15.0128ZM14.2424 21.9419L10.8752 19.9981C10.8576 19.9893 10.8423 19.9763 10.8309 19.9602C10.8195 19.9441 10.8122 19.9254 10.8098 19.9058V10.6071C10.8107 9.18295 11.2173 7.78848 11.9819 6.58696C12.7466 5.38544 13.8377 4.42659 15.1275 3.82264C16.4173 3.21869 17.8524 2.99464 19.2649 3.1767C20.6775 3.35876 22.0089 3.93941 23.1034 4.85067C23.0427 4.88379 22.937 4.94215 22.8668 4.98473L14.9024 9.58517C14.7025 9.69878 14.5366 9.86356 14.4215 10.0626C14.3065 10.2616 14.2466 10.4877 14.2479 10.7175L14.2424 21.9419ZM16.071 17.9991L20.4018 15.4978L24.7325 17.9975V22.9985L20.4018 25.4983L16.071 22.9985V17.9991Z" fill="currentColor"></path></svg></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4"><div class="request-:R2d6:-2 markdown prose dark:prose-invert break-words dark"><p>Here is a simple example of a program that can read a DNA sequence and explain its functions:</p><pre><div class="bg-black"><div class="flex items-center relative text-gray-200 bg-gray-800 px-4 py-2 text-xs font-sans"><button class="flex ml-auto gap-2"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M16 4h2a2 2 0 0 1 2 2v14a2 2 0 0 1-2 2H6a2 2 0 0 1-2-2V6a2 2 0 0 1 2-2h2"></path><rect x="8" y="2" width="8" height="4" rx="1" ry="1"></rect></svg>Copy code</button></div><div class="p-4"><code class="!whitespace-pre-wrap hljs language-python"><span class="hljs-comment"># define a function to read a DNA sequence and return its functions</span>
<span class="hljs-keyword">def</span> <span class="hljs-title function_">read_dna_sequence</span>(<span class="hljs-params">sequence</span>):
<span class="hljs-comment"># create a dictionary to store the functions of each nucleotide</span>
nucleotide_functions = {
<span class="hljs-string">'A'</span>: <span class="hljs-string">'adenine'</span>,
<span class="hljs-string">'T'</span>: <span class="hljs-string">'thymine'</span>,
<span class="hljs-string">'C'</span>: <span class="hljs-string">'cytosine'</span>,
<span class="hljs-string">'G'</span>: <span class="hljs-string">'guanine'</span>
}
<span class="hljs-comment"># initialize an empty list to store the functions of the DNA sequence</span>
sequence_functions = []
<span class="hljs-comment"># iterate over the nucleotides in the DNA sequence</span>
<span class="hljs-keyword">for</span> nucleotide <span class="hljs-keyword">in</span> sequence:
<span class="hljs-comment"># add the function of the current nucleotide to the list</span>
sequence_functions.append(nucleotide_functions[nucleotide])
<span class="hljs-comment"># return the list of functions for the DNA sequence</span>
<span class="hljs-keyword">return</span> sequence_functions
<span class="hljs-comment"># test the function with a sample DNA sequence</span>
dna_sequence = <span class="hljs-string">"ATCGAGTCGATCGTAGCTAGCTAGCTAGCTAGCTACGTAGCTACGATCG"</span>
<span class="hljs-built_in">print</span>(read_dna_sequence(dna_sequence))
</code></div></div></pre><p>In this code, the <code>read_dna_sequence</code>
function takes a DNA sequence as input and returns a list of the
functions of each nucleotide in the sequence. The function uses a
dictionary to store the functions of each nucleotide (adenine, thymine,
cytosine, and guanine), and then iterates over the nucleotides in the
DNA sequence to add their functions to a list. Finally, the function
returns the list of nucleotide functions for the DNA sequence.</p></div></div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M14 9V5a3 3 0 0 0-3-3l-4 9v11h11.28a2 2 0 0 0 2-1.7l1.38-9a2 2 0 0 0-2-2.3zM7 22H4a2 2 0 0 1-2-2v-7a2 2 0 0 1 2-2h3"></path></svg></button><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M10 15v4a3 3 0 0 0 3 3l4-9V2H5.72a2 2 0 0 0-2 1.7l-1.38 9a2 2 0 0 0 2 2.3zm7-13h2.67A2.31 2.31 0 0 1 22 4v7a2.31 2.31 0 0 1-2.33 2H17"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group dark:bg-gray-800"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative flex"><span style="box-sizing: border-box; display: inline-block; overflow: hidden; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; position: relative; max-width: 100%;"><span style="box-sizing: border-box; display: block; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; max-width: 100%;"><img alt="" aria-hidden="true" src="data:image/svg+xml,%3csvg%20xmlns=%27http://www.w3.org/2000/svg%27%20version=%271.1%27%20width=%2730%27%20height=%2730%27/%3e" style="display: block; max-width: 100%; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px;"></span><img alt="Félix" srcset="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=32&amp;q=75 1x, /_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75 2x" src="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75" decoding="async" data-nimg="intrinsic" class="rounded-sm" style="position: absolute; inset: 0px; box-sizing: border-box; padding: 0px; border: none; margin: auto; display: block; width: 0px; height: 0px; min-width: 100%; max-width: 100%; min-height: 100%; max-height: 100%;"></span></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4">Can you explain what are the nucleotide functions and what are they used for ?</div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M11 4H4a2 2 0 0 0-2 2v14a2 2 0 0 0 2 2h14a2 2 0 0 0 2-2v-7"></path><path d="M18.5 2.5a2.121 2.121 0 0 1 3 3L12 15l-4 1 1-4 9.5-9.5z"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group bg-gray-50 dark:bg-[#444654]"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative h-[30px] w-[30px] p-1 rounded-sm text-white flex items-center justify-center" style="background-color: rgb(16, 163, 127);"><svg width="41" height="41" viewBox="0 0 41 41" fill="none" xmlns="http://www.w3.org/2000/svg" stroke-width="1.5" class="w-6 h-6"><path d="M37.5324 16.8707C37.9808 15.5241 38.1363 14.0974 37.9886 12.6859C37.8409 11.2744 37.3934 9.91076 36.676 8.68622C35.6126 6.83404 33.9882 5.3676 32.0373 4.4985C30.0864 3.62941 27.9098 3.40259 25.8215 3.85078C24.8796 2.7893 23.7219 1.94125 22.4257 1.36341C21.1295 0.785575 19.7249 0.491269 18.3058 0.500197C16.1708 0.495044 14.0893 1.16803 12.3614 2.42214C10.6335 3.67624 9.34853 5.44666 8.6917 7.47815C7.30085 7.76286 5.98686 8.3414 4.8377 9.17505C3.68854 10.0087 2.73073 11.0782 2.02839 12.312C0.956464 14.1591 0.498905 16.2988 0.721698 18.4228C0.944492 20.5467 1.83612 22.5449 3.268 24.1293C2.81966 25.4759 2.66413 26.9026 2.81182 28.3141C2.95951 29.7256 3.40701 31.0892 4.12437 32.3138C5.18791 34.1659 6.8123 35.6322 8.76321 36.5013C10.7141 37.3704 12.8907 37.5973 14.9789 37.1492C15.9208 38.2107 17.0786 39.0587 18.3747 39.6366C19.6709 40.2144 21.0755 40.5087 22.4946 40.4998C24.6307 40.5054 26.7133 39.8321 28.4418 38.5772C30.1704 37.3223 31.4556 35.5506 32.1119 33.5179C33.5027 33.2332 34.8167 32.6547 35.9659 31.821C37.115 30.9874 38.0728 29.9178 38.7752 28.684C39.8458 26.8371 40.3023 24.6979 40.0789 22.5748C39.8556 20.4517 38.9639 18.4544 37.5324 16.8707ZM22.4978 37.8849C20.7443 37.8874 19.0459 37.2733 17.6994 36.1501C17.7601 36.117 17.8666 36.0586 17.936 36.0161L25.9004 31.4156C26.1003 31.3019 26.2663 31.137 26.3813 30.9378C26.4964 30.7386 26.5563 30.5124 26.5549 30.2825V19.0542L29.9213 20.998C29.9389 21.0068 29.9541 21.0198 29.9656 21.0359C29.977 21.052 29.9842 21.0707 29.9867 21.0902V30.3889C29.9842 32.375 29.1946 34.2791 27.7909 35.6841C26.3872 37.0892 24.4838 37.8806 22.4978 37.8849ZM6.39227 31.0064C5.51397 29.4888 5.19742 27.7107 5.49804 25.9832C5.55718 26.0187 5.66048 26.0818 5.73461 26.1244L13.699 30.7248C13.8975 30.8408 14.1233 30.902 14.3532 30.902C14.583 30.902 14.8088 30.8408 15.0073 30.7248L24.731 25.1103V28.9979C24.7321 29.0177 24.7283 29.0376 24.7199 29.0556C24.7115 29.0736 24.6988 29.0893 24.6829 29.1012L16.6317 33.7497C14.9096 34.7416 12.8643 35.0097 10.9447 34.4954C9.02506 33.9811 7.38785 32.7263 6.39227 31.0064ZM4.29707 13.6194C5.17156 12.0998 6.55279 10.9364 8.19885 10.3327C8.19885 10.4013 8.19491 10.5228 8.19491 10.6071V19.808C8.19351 20.0378 8.25334 20.2638 8.36823 20.4629C8.48312 20.6619 8.64893 20.8267 8.84863 20.9404L18.5723 26.5542L15.206 28.4979C15.1894 28.5089 15.1703 28.5155 15.1505 28.5173C15.1307 28.5191 15.1107 28.516 15.0924 28.5082L7.04046 23.8557C5.32135 22.8601 4.06716 21.2235 3.55289 19.3046C3.03862 17.3858 3.30624 15.3413 4.29707 13.6194ZM31.955 20.0556L22.2312 14.4411L25.5976 12.4981C25.6142 12.4872 25.6333 12.4805 25.6531 12.4787C25.6729 12.4769 25.6928 12.4801 25.7111 12.4879L33.7631 17.1364C34.9967 17.849 36.0017 18.8982 36.6606 20.1613C37.3194 21.4244 37.6047 22.849 37.4832 24.2684C37.3617 25.6878 36.8382 27.0432 35.9743 28.1759C35.1103 29.3086 33.9415 30.1717 32.6047 30.6641C32.6047 30.5947 32.6047 30.4733 32.6047 30.3889V21.188C32.6066 20.9586 32.5474 20.7328 32.4332 20.5338C32.319 20.3348 32.154 20.1698 31.955 20.0556ZM35.3055 15.0128C35.2464 14.9765 35.1431 14.9142 35.069 14.8717L27.1045 10.2712C26.906 10.1554 26.6803 10.0943 26.4504 10.0943C26.2206 10.0943 25.9948 10.1554 25.7963 10.2712L16.0726 15.8858V11.9982C16.0715 11.9783 16.0753 11.9585 16.0837 11.9405C16.0921 11.9225 16.1048 11.9068 16.1207 11.8949L24.1719 7.25025C25.4053 6.53903 26.8158 6.19376 28.2383 6.25482C29.6608 6.31589 31.0364 6.78077 32.2044 7.59508C33.3723 8.40939 34.2842 9.53945 34.8334 10.8531C35.3826 12.1667 35.5464 13.6095 35.3055 15.0128ZM14.2424 21.9419L10.8752 19.9981C10.8576 19.9893 10.8423 19.9763 10.8309 19.9602C10.8195 19.9441 10.8122 19.9254 10.8098 19.9058V10.6071C10.8107 9.18295 11.2173 7.78848 11.9819 6.58696C12.7466 5.38544 13.8377 4.42659 15.1275 3.82264C16.4173 3.21869 17.8524 2.99464 19.2649 3.1767C20.6775 3.35876 22.0089 3.93941 23.1034 4.85067C23.0427 4.88379 22.937 4.94215 22.8668 4.98473L14.9024 9.58517C14.7025 9.69878 14.5366 9.86356 14.4215 10.0626C14.3065 10.2616 14.2466 10.4877 14.2479 10.7175L14.2424 21.9419ZM16.071 17.9991L20.4018 15.4978L24.7325 17.9975V22.9985L20.4018 25.4983L16.071 22.9985V17.9991Z" fill="currentColor"></path></svg></div><div class="text-xs flex items-center justify-center gap-1 absolute left-0 -translate-x-full top-2 -ml-4 invisible group-hover:visible"><button class="dark:text-white disabled:text-gray-300 dark:disabled:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="1.5" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-3 h-3" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><polyline points="15 18 9 12 15 6"></polyline></svg></button><span class="flex-grow flex-shrink-0">2 / 2</span><button class="dark:text-white disabled:text-gray-300 dark:disabled:text-gray-400" disabled="disabled"><svg stroke="currentColor" fill="none" stroke-width="1.5" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-3 h-3" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><polyline points="9 18 15 12 9 6"></polyline></svg></button></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4"><div class="request-:R2d6:-4 markdown prose dark:prose-invert break-words dark"><p>In
biology, a nucleotide is a molecule that is the building block of DNA
and RNA. DNA and RNA are important biological molecules that store and
transmit genetic information in living organisms. Each nucleotide is
made up of three components: a nitrogenous base, a five-carbon sugar,
and a phosphate group. There are four different nitrogenous bases in DNA
and RNA: adenine, thymine, cytosine, and guanine. The specific sequence
of these bases in a DNA or RNA molecule determines the genetic
information it carries.</p><p>The function of nucleotides in DNA and RNA
is to store and transmit genetic information. The specific sequence of
nucleotides in a DNA or RNA molecule encodes the instructions needed for
the synthesis of proteins, which are the fundamental building blocks of
life. The four different nitrogenous bases in DNA and RNA each have a
specific function. Adenine and thymine are complementary bases and form a
stable double-stranded structure in DNA, while cytosine and guanine are
also complementary and form a double-stranded structure in RNA. These
complementary base pairs are crucial for the stable and accurate
transmission of genetic information.</p></div></div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M14 9V5a3 3 0 0 0-3-3l-4 9v11h11.28a2 2 0 0 0 2-1.7l1.38-9a2 2 0 0 0-2-2.3zM7 22H4a2 2 0 0 1-2-2v-7a2 2 0 0 1 2-2h3"></path></svg></button><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M10 15v4a3 3 0 0 0 3 3l4-9V2H5.72a2 2 0 0 0-2 1.7l-1.38 9a2 2 0 0 0 2 2.3zm7-13h2.67A2.31 2.31 0 0 1 22 4v7a2.31 2.31 0 0 1-2.33 2H17"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group dark:bg-gray-800"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative flex"><span style="box-sizing: border-box; display: inline-block; overflow: hidden; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; position: relative; max-width: 100%;"><span style="box-sizing: border-box; display: block; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; max-width: 100%;"><img alt="" aria-hidden="true" src="data:image/svg+xml,%3csvg%20xmlns=%27http://www.w3.org/2000/svg%27%20version=%271.1%27%20width=%2730%27%20height=%2730%27/%3e" style="display: block; max-width: 100%; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px;"></span><img alt="Félix" srcset="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=32&amp;q=75 1x, /_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75 2x" src="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75" decoding="async" data-nimg="intrinsic" class="rounded-sm" style="position: absolute; inset: 0px; box-sizing: border-box; padding: 0px; border: none; margin: auto; display: block; width: 0px; height: 0px; min-width: 100%; max-width: 100%; min-height: 100%; max-height: 100%;"></span></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4">How to know what protein will be build by which dna sequence</div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M11 4H4a2 2 0 0 0-2 2v14a2 2 0 0 0 2 2h14a2 2 0 0 0 2-2v-7"></path><path d="M18.5 2.5a2.121 2.121 0 0 1 3 3L12 15l-4 1 1-4 9.5-9.5z"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group bg-gray-50 dark:bg-[#444654]"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative h-[30px] w-[30px] p-1 rounded-sm text-white flex items-center justify-center" style="background-color: rgb(16, 163, 127);"><svg width="41" height="41" viewBox="0 0 41 41" fill="none" xmlns="http://www.w3.org/2000/svg" stroke-width="1.5" class="w-6 h-6"><path d="M37.5324 16.8707C37.9808 15.5241 38.1363 14.0974 37.9886 12.6859C37.8409 11.2744 37.3934 9.91076 36.676 8.68622C35.6126 6.83404 33.9882 5.3676 32.0373 4.4985C30.0864 3.62941 27.9098 3.40259 25.8215 3.85078C24.8796 2.7893 23.7219 1.94125 22.4257 1.36341C21.1295 0.785575 19.7249 0.491269 18.3058 0.500197C16.1708 0.495044 14.0893 1.16803 12.3614 2.42214C10.6335 3.67624 9.34853 5.44666 8.6917 7.47815C7.30085 7.76286 5.98686 8.3414 4.8377 9.17505C3.68854 10.0087 2.73073 11.0782 2.02839 12.312C0.956464 14.1591 0.498905 16.2988 0.721698 18.4228C0.944492 20.5467 1.83612 22.5449 3.268 24.1293C2.81966 25.4759 2.66413 26.9026 2.81182 28.3141C2.95951 29.7256 3.40701 31.0892 4.12437 32.3138C5.18791 34.1659 6.8123 35.6322 8.76321 36.5013C10.7141 37.3704 12.8907 37.5973 14.9789 37.1492C15.9208 38.2107 17.0786 39.0587 18.3747 39.6366C19.6709 40.2144 21.0755 40.5087 22.4946 40.4998C24.6307 40.5054 26.7133 39.8321 28.4418 38.5772C30.1704 37.3223 31.4556 35.5506 32.1119 33.5179C33.5027 33.2332 34.8167 32.6547 35.9659 31.821C37.115 30.9874 38.0728 29.9178 38.7752 28.684C39.8458 26.8371 40.3023 24.6979 40.0789 22.5748C39.8556 20.4517 38.9639 18.4544 37.5324 16.8707ZM22.4978 37.8849C20.7443 37.8874 19.0459 37.2733 17.6994 36.1501C17.7601 36.117 17.8666 36.0586 17.936 36.0161L25.9004 31.4156C26.1003 31.3019 26.2663 31.137 26.3813 30.9378C26.4964 30.7386 26.5563 30.5124 26.5549 30.2825V19.0542L29.9213 20.998C29.9389 21.0068 29.9541 21.0198 29.9656 21.0359C29.977 21.052 29.9842 21.0707 29.9867 21.0902V30.3889C29.9842 32.375 29.1946 34.2791 27.7909 35.6841C26.3872 37.0892 24.4838 37.8806 22.4978 37.8849ZM6.39227 31.0064C5.51397 29.4888 5.19742 27.7107 5.49804 25.9832C5.55718 26.0187 5.66048 26.0818 5.73461 26.1244L13.699 30.7248C13.8975 30.8408 14.1233 30.902 14.3532 30.902C14.583 30.902 14.8088 30.8408 15.0073 30.7248L24.731 25.1103V28.9979C24.7321 29.0177 24.7283 29.0376 24.7199 29.0556C24.7115 29.0736 24.6988 29.0893 24.6829 29.1012L16.6317 33.7497C14.9096 34.7416 12.8643 35.0097 10.9447 34.4954C9.02506 33.9811 7.38785 32.7263 6.39227 31.0064ZM4.29707 13.6194C5.17156 12.0998 6.55279 10.9364 8.19885 10.3327C8.19885 10.4013 8.19491 10.5228 8.19491 10.6071V19.808C8.19351 20.0378 8.25334 20.2638 8.36823 20.4629C8.48312 20.6619 8.64893 20.8267 8.84863 20.9404L18.5723 26.5542L15.206 28.4979C15.1894 28.5089 15.1703 28.5155 15.1505 28.5173C15.1307 28.5191 15.1107 28.516 15.0924 28.5082L7.04046 23.8557C5.32135 22.8601 4.06716 21.2235 3.55289 19.3046C3.03862 17.3858 3.30624 15.3413 4.29707 13.6194ZM31.955 20.0556L22.2312 14.4411L25.5976 12.4981C25.6142 12.4872 25.6333 12.4805 25.6531 12.4787C25.6729 12.4769 25.6928 12.4801 25.7111 12.4879L33.7631 17.1364C34.9967 17.849 36.0017 18.8982 36.6606 20.1613C37.3194 21.4244 37.6047 22.849 37.4832 24.2684C37.3617 25.6878 36.8382 27.0432 35.9743 28.1759C35.1103 29.3086 33.9415 30.1717 32.6047 30.6641C32.6047 30.5947 32.6047 30.4733 32.6047 30.3889V21.188C32.6066 20.9586 32.5474 20.7328 32.4332 20.5338C32.319 20.3348 32.154 20.1698 31.955 20.0556ZM35.3055 15.0128C35.2464 14.9765 35.1431 14.9142 35.069 14.8717L27.1045 10.2712C26.906 10.1554 26.6803 10.0943 26.4504 10.0943C26.2206 10.0943 25.9948 10.1554 25.7963 10.2712L16.0726 15.8858V11.9982C16.0715 11.9783 16.0753 11.9585 16.0837 11.9405C16.0921 11.9225 16.1048 11.9068 16.1207 11.8949L24.1719 7.25025C25.4053 6.53903 26.8158 6.19376 28.2383 6.25482C29.6608 6.31589 31.0364 6.78077 32.2044 7.59508C33.3723 8.40939 34.2842 9.53945 34.8334 10.8531C35.3826 12.1667 35.5464 13.6095 35.3055 15.0128ZM14.2424 21.9419L10.8752 19.9981C10.8576 19.9893 10.8423 19.9763 10.8309 19.9602C10.8195 19.9441 10.8122 19.9254 10.8098 19.9058V10.6071C10.8107 9.18295 11.2173 7.78848 11.9819 6.58696C12.7466 5.38544 13.8377 4.42659 15.1275 3.82264C16.4173 3.21869 17.8524 2.99464 19.2649 3.1767C20.6775 3.35876 22.0089 3.93941 23.1034 4.85067C23.0427 4.88379 22.937 4.94215 22.8668 4.98473L14.9024 9.58517C14.7025 9.69878 14.5366 9.86356 14.4215 10.0626C14.3065 10.2616 14.2466 10.4877 14.2479 10.7175L14.2424 21.9419ZM16.071 17.9991L20.4018 15.4978L24.7325 17.9975V22.9985L20.4018 25.4983L16.071 22.9985V17.9991Z" fill="currentColor"></path></svg></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4"><div class="request-:R2d6:-5 markdown prose dark:prose-invert break-words dark"><p>To
determine what protein will be built from a specific DNA sequence, we
first need to understand the central dogma of molecular biology. The
central dogma states that DNA stores genetic information, which is then
transcribed into RNA, and then translated into proteins. In other words,
the sequence of nucleotides in a DNA molecule determines the sequence
of amino acids in a protein.</p><p>To determine the protein that will be built from a specific DNA sequence, we need to follow these steps:</p><ol><li><p>First,
the DNA sequence must be transcribed into RNA. This is done by the
enzyme RNA polymerase, which reads the DNA sequence and produces a
complementary RNA molecule.</p></li><li><p>Next, the RNA molecule must
be translated into a protein. This is done by ribosomes, which are
molecular machines that read the RNA sequence and use it to synthesize a
protein. The specific sequence of nucleotides in the RNA molecule
determines the specific sequence of amino acids in the protein.</p></li><li><p>Finally,
the protein can be folded into its three-dimensional structure, which
determines its function. Proteins are incredibly complex molecules with a
wide range of functions, from catalyzing chemical reactions to
providing structural support to cells.</p></li></ol><p>In summary, the
sequence of nucleotides in a DNA molecule determines the sequence of
amino acids in a protein, and this sequence determines the protein's
three-dimensional structure and function.</p></div></div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M14 9V5a3 3 0 0 0-3-3l-4 9v11h11.28a2 2 0 0 0 2-1.7l1.38-9a2 2 0 0 0-2-2.3zM7 22H4a2 2 0 0 1-2-2v-7a2 2 0 0 1 2-2h3"></path></svg></button><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M10 15v4a3 3 0 0 0 3 3l4-9V2H5.72a2 2 0 0 0-2 1.7l-1.38 9a2 2 0 0 0 2 2.3zm7-13h2.67A2.31 2.31 0 0 1 22 4v7a2.31 2.31 0 0 1-2.33 2H17"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group dark:bg-gray-800"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative flex"><span style="box-sizing: border-box; display: inline-block; overflow: hidden; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; position: relative; max-width: 100%;"><span style="box-sizing: border-box; display: block; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; max-width: 100%;"><img alt="" aria-hidden="true" src="data:image/svg+xml,%3csvg%20xmlns=%27http://www.w3.org/2000/svg%27%20version=%271.1%27%20width=%2730%27%20height=%2730%27/%3e" style="display: block; max-width: 100%; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px;"></span><img alt="Félix" srcset="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=32&amp;q=75 1x, /_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75 2x" src="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75" decoding="async" data-nimg="intrinsic" class="rounded-sm" style="position: absolute; inset: 0px; box-sizing: border-box; padding: 0px; border: none; margin: auto; display: block; width: 0px; height: 0px; min-width: 100%; max-width: 100%; min-height: 100%; max-height: 100%;"></span></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4">Generate the code for dna to rna translater</div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M11 4H4a2 2 0 0 0-2 2v14a2 2 0 0 0 2 2h14a2 2 0 0 0 2-2v-7"></path><path d="M18.5 2.5a2.121 2.121 0 0 1 3 3L12 15l-4 1 1-4 9.5-9.5z"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group bg-gray-50 dark:bg-[#444654]"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative h-[30px] w-[30px] p-1 rounded-sm text-white flex items-center justify-center" style="background-color: rgb(16, 163, 127);"><svg width="41" height="41" viewBox="0 0 41 41" fill="none" xmlns="http://www.w3.org/2000/svg" stroke-width="1.5" class="w-6 h-6"><path d="M37.5324 16.8707C37.9808 15.5241 38.1363 14.0974 37.9886 12.6859C37.8409 11.2744 37.3934 9.91076 36.676 8.68622C35.6126 6.83404 33.9882 5.3676 32.0373 4.4985C30.0864 3.62941 27.9098 3.40259 25.8215 3.85078C24.8796 2.7893 23.7219 1.94125 22.4257 1.36341C21.1295 0.785575 19.7249 0.491269 18.3058 0.500197C16.1708 0.495044 14.0893 1.16803 12.3614 2.42214C10.6335 3.67624 9.34853 5.44666 8.6917 7.47815C7.30085 7.76286 5.98686 8.3414 4.8377 9.17505C3.68854 10.0087 2.73073 11.0782 2.02839 12.312C0.956464 14.1591 0.498905 16.2988 0.721698 18.4228C0.944492 20.5467 1.83612 22.5449 3.268 24.1293C2.81966 25.4759 2.66413 26.9026 2.81182 28.3141C2.95951 29.7256 3.40701 31.0892 4.12437 32.3138C5.18791 34.1659 6.8123 35.6322 8.76321 36.5013C10.7141 37.3704 12.8907 37.5973 14.9789 37.1492C15.9208 38.2107 17.0786 39.0587 18.3747 39.6366C19.6709 40.2144 21.0755 40.5087 22.4946 40.4998C24.6307 40.5054 26.7133 39.8321 28.4418 38.5772C30.1704 37.3223 31.4556 35.5506 32.1119 33.5179C33.5027 33.2332 34.8167 32.6547 35.9659 31.821C37.115 30.9874 38.0728 29.9178 38.7752 28.684C39.8458 26.8371 40.3023 24.6979 40.0789 22.5748C39.8556 20.4517 38.9639 18.4544 37.5324 16.8707ZM22.4978 37.8849C20.7443 37.8874 19.0459 37.2733 17.6994 36.1501C17.7601 36.117 17.8666 36.0586 17.936 36.0161L25.9004 31.4156C26.1003 31.3019 26.2663 31.137 26.3813 30.9378C26.4964 30.7386 26.5563 30.5124 26.5549 30.2825V19.0542L29.9213 20.998C29.9389 21.0068 29.9541 21.0198 29.9656 21.0359C29.977 21.052 29.9842 21.0707 29.9867 21.0902V30.3889C29.9842 32.375 29.1946 34.2791 27.7909 35.6841C26.3872 37.0892 24.4838 37.8806 22.4978 37.8849ZM6.39227 31.0064C5.51397 29.4888 5.19742 27.7107 5.49804 25.9832C5.55718 26.0187 5.66048 26.0818 5.73461 26.1244L13.699 30.7248C13.8975 30.8408 14.1233 30.902 14.3532 30.902C14.583 30.902 14.8088 30.8408 15.0073 30.7248L24.731 25.1103V28.9979C24.7321 29.0177 24.7283 29.0376 24.7199 29.0556C24.7115 29.0736 24.6988 29.0893 24.6829 29.1012L16.6317 33.7497C14.9096 34.7416 12.8643 35.0097 10.9447 34.4954C9.02506 33.9811 7.38785 32.7263 6.39227 31.0064ZM4.29707 13.6194C5.17156 12.0998 6.55279 10.9364 8.19885 10.3327C8.19885 10.4013 8.19491 10.5228 8.19491 10.6071V19.808C8.19351 20.0378 8.25334 20.2638 8.36823 20.4629C8.48312 20.6619 8.64893 20.8267 8.84863 20.9404L18.5723 26.5542L15.206 28.4979C15.1894 28.5089 15.1703 28.5155 15.1505 28.5173C15.1307 28.5191 15.1107 28.516 15.0924 28.5082L7.04046 23.8557C5.32135 22.8601 4.06716 21.2235 3.55289 19.3046C3.03862 17.3858 3.30624 15.3413 4.29707 13.6194ZM31.955 20.0556L22.2312 14.4411L25.5976 12.4981C25.6142 12.4872 25.6333 12.4805 25.6531 12.4787C25.6729 12.4769 25.6928 12.4801 25.7111 12.4879L33.7631 17.1364C34.9967 17.849 36.0017 18.8982 36.6606 20.1613C37.3194 21.4244 37.6047 22.849 37.4832 24.2684C37.3617 25.6878 36.8382 27.0432 35.9743 28.1759C35.1103 29.3086 33.9415 30.1717 32.6047 30.6641C32.6047 30.5947 32.6047 30.4733 32.6047 30.3889V21.188C32.6066 20.9586 32.5474 20.7328 32.4332 20.5338C32.319 20.3348 32.154 20.1698 31.955 20.0556ZM35.3055 15.0128C35.2464 14.9765 35.1431 14.9142 35.069 14.8717L27.1045 10.2712C26.906 10.1554 26.6803 10.0943 26.4504 10.0943C26.2206 10.0943 25.9948 10.1554 25.7963 10.2712L16.0726 15.8858V11.9982C16.0715 11.9783 16.0753 11.9585 16.0837 11.9405C16.0921 11.9225 16.1048 11.9068 16.1207 11.8949L24.1719 7.25025C25.4053 6.53903 26.8158 6.19376 28.2383 6.25482C29.6608 6.31589 31.0364 6.78077 32.2044 7.59508C33.3723 8.40939 34.2842 9.53945 34.8334 10.8531C35.3826 12.1667 35.5464 13.6095 35.3055 15.0128ZM14.2424 21.9419L10.8752 19.9981C10.8576 19.9893 10.8423 19.9763 10.8309 19.9602C10.8195 19.9441 10.8122 19.9254 10.8098 19.9058V10.6071C10.8107 9.18295 11.2173 7.78848 11.9819 6.58696C12.7466 5.38544 13.8377 4.42659 15.1275 3.82264C16.4173 3.21869 17.8524 2.99464 19.2649 3.1767C20.6775 3.35876 22.0089 3.93941 23.1034 4.85067C23.0427 4.88379 22.937 4.94215 22.8668 4.98473L14.9024 9.58517C14.7025 9.69878 14.5366 9.86356 14.4215 10.0626C14.3065 10.2616 14.2466 10.4877 14.2479 10.7175L14.2424 21.9419ZM16.071 17.9991L20.4018 15.4978L24.7325 17.9975V22.9985L20.4018 25.4983L16.071 22.9985V17.9991Z" fill="currentColor"></path></svg></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4"><div class="request-:R2d6:-6 markdown prose dark:prose-invert break-words dark"><p>Here is a simple example of a program that can translate a DNA sequence into its corresponding RNA sequence:</p><pre><div class="bg-black"><div class="flex items-center relative text-gray-200 bg-gray-800 px-4 py-2 text-xs font-sans"><button class="flex ml-auto gap-2"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M16 4h2a2 2 0 0 1 2 2v14a2 2 0 0 1-2 2H6a2 2 0 0 1-2-2V6a2 2 0 0 1 2-2h2"></path><rect x="8" y="2" width="8" height="4" rx="1" ry="1"></rect></svg>Copy code</button></div><div class="p-4"><code class="!whitespace-pre-wrap hljs language-python"><span class="hljs-comment"># define a function to translate a DNA sequence into RNA</span>
<span class="hljs-keyword">def</span> <span class="hljs-title function_">dna_to_rna</span>(<span class="hljs-params">dna_sequence</span>):
<span class="hljs-comment"># create a dictionary to store the RNA nucleotide for each DNA nucleotide</span>
dna_to_rna_nucleotides = {
<span class="hljs-string">'A'</span>: <span class="hljs-string">'U'</span>,
<span class="hljs-string">'T'</span>: <span class="hljs-string">'A'</span>,
<span class="hljs-string">'C'</span>: <span class="hljs-string">'G'</span>,
<span class="hljs-string">'G'</span>: <span class="hljs-string">'C'</span>
}
<span class="hljs-comment"># initialize an empty string to store the RNA sequence</span>
rna_sequence = <span class="hljs-string">""</span>
<span class="hljs-comment"># iterate over the nucleotides in the DNA sequence</span>
<span class="hljs-keyword">for</span> nucleotide <span class="hljs-keyword">in</span> dna_sequence:
<span class="hljs-comment"># add the corresponding RNA nucleotide to the RNA sequence string</span>
rna_sequence += dna_to_rna_nucleotides[nucleotide]
<span class="hljs-comment"># return the RNA sequence</span>
<span class="hljs-keyword">return</span> rna_sequence
<span class="hljs-comment"># test the function with a sample DNA sequence</span>
dna_sequence = <span class="hljs-string">"ATCGAGTCGATCGTAGCTAGCTAGCTAGCTAGCTACGTAGCTACGATCG"</span>
<span class="hljs-built_in">print</span>(dna_to_rna(dna_sequence))
</code></div></div></pre><p>In this code, the <code>dna_to_rna</code>
function takes a DNA sequence as input and returns the corresponding RNA
sequence. The function uses a dictionary to store the RNA nucleotide
that corresponds to each DNA nucleotide (A, T, C, and G), and then
iterates over the nucleotides in the DNA sequence to add the
corresponding RNA nucleotides to a string. Finally, the function returns
the RNA sequence.</p></div></div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M14 9V5a3 3 0 0 0-3-3l-4 9v11h11.28a2 2 0 0 0 2-1.7l1.38-9a2 2 0 0 0-2-2.3zM7 22H4a2 2 0 0 1-2-2v-7a2 2 0 0 1 2-2h3"></path></svg></button><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M10 15v4a3 3 0 0 0 3 3l4-9V2H5.72a2 2 0 0 0-2 1.7l-1.38 9a2 2 0 0 0 2 2.3zm7-13h2.67A2.31 2.31 0 0 1 22 4v7a2.31 2.31 0 0 1-2.33 2H17"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group dark:bg-gray-800"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative flex"><span style="box-sizing: border-box; display: inline-block; overflow: hidden; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; position: relative; max-width: 100%;"><span style="box-sizing: border-box; display: block; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; max-width: 100%;"><img alt="" aria-hidden="true" src="data:image/svg+xml,%3csvg%20xmlns=%27http://www.w3.org/2000/svg%27%20version=%271.1%27%20width=%2730%27%20height=%2730%27/%3e" style="display: block; max-width: 100%; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px;"></span><img alt="Félix" srcset="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=32&amp;q=75 1x, /_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75 2x" src="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75" decoding="async" data-nimg="intrinsic" class="rounded-sm" style="position: absolute; inset: 0px; box-sizing: border-box; padding: 0px; border: none; margin: auto; display: block; width: 0px; height: 0px; min-width: 100%; max-width: 100%; min-height: 100%; max-height: 100%;"></span></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4">Generate the code to translate a sequence of nucleotides to a sequence of amino acids</div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M11 4H4a2 2 0 0 0-2 2v14a2 2 0 0 0 2 2h14a2 2 0 0 0 2-2v-7"></path><path d="M18.5 2.5a2.121 2.121 0 0 1 3 3L12 15l-4 1 1-4 9.5-9.5z"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group bg-gray-50 dark:bg-[#444654]"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative h-[30px] w-[30px] p-1 rounded-sm text-white flex items-center justify-center" style="background-color: rgb(16, 163, 127);"><svg width="41" height="41" viewBox="0 0 41 41" fill="none" xmlns="http://www.w3.org/2000/svg" stroke-width="1.5" class="w-6 h-6"><path d="M37.5324 16.8707C37.9808 15.5241 38.1363 14.0974 37.9886 12.6859C37.8409 11.2744 37.3934 9.91076 36.676 8.68622C35.6126 6.83404 33.9882 5.3676 32.0373 4.4985C30.0864 3.62941 27.9098 3.40259 25.8215 3.85078C24.8796 2.7893 23.7219 1.94125 22.4257 1.36341C21.1295 0.785575 19.7249 0.491269 18.3058 0.500197C16.1708 0.495044 14.0893 1.16803 12.3614 2.42214C10.6335 3.67624 9.34853 5.44666 8.6917 7.47815C7.30085 7.76286 5.98686 8.3414 4.8377 9.17505C3.68854 10.0087 2.73073 11.0782 2.02839 12.312C0.956464 14.1591 0.498905 16.2988 0.721698 18.4228C0.944492 20.5467 1.83612 22.5449 3.268 24.1293C2.81966 25.4759 2.66413 26.9026 2.81182 28.3141C2.95951 29.7256 3.40701 31.0892 4.12437 32.3138C5.18791 34.1659 6.8123 35.6322 8.76321 36.5013C10.7141 37.3704 12.8907 37.5973 14.9789 37.1492C15.9208 38.2107 17.0786 39.0587 18.3747 39.6366C19.6709 40.2144 21.0755 40.5087 22.4946 40.4998C24.6307 40.5054 26.7133 39.8321 28.4418 38.5772C30.1704 37.3223 31.4556 35.5506 32.1119 33.5179C33.5027 33.2332 34.8167 32.6547 35.9659 31.821C37.115 30.9874 38.0728 29.9178 38.7752 28.684C39.8458 26.8371 40.3023 24.6979 40.0789 22.5748C39.8556 20.4517 38.9639 18.4544 37.5324 16.8707ZM22.4978 37.8849C20.7443 37.8874 19.0459 37.2733 17.6994 36.1501C17.7601 36.117 17.8666 36.0586 17.936 36.0161L25.9004 31.4156C26.1003 31.3019 26.2663 31.137 26.3813 30.9378C26.4964 30.7386 26.5563 30.5124 26.5549 30.2825V19.0542L29.9213 20.998C29.9389 21.0068 29.9541 21.0198 29.9656 21.0359C29.977 21.052 29.9842 21.0707 29.9867 21.0902V30.3889C29.9842 32.375 29.1946 34.2791 27.7909 35.6841C26.3872 37.0892 24.4838 37.8806 22.4978 37.8849ZM6.39227 31.0064C5.51397 29.4888 5.19742 27.7107 5.49804 25.9832C5.55718 26.0187 5.66048 26.0818 5.73461 26.1244L13.699 30.7248C13.8975 30.8408 14.1233 30.902 14.3532 30.902C14.583 30.902 14.8088 30.8408 15.0073 30.7248L24.731 25.1103V28.9979C24.7321 29.0177 24.7283 29.0376 24.7199 29.0556C24.7115 29.0736 24.6988 29.0893 24.6829 29.1012L16.6317 33.7497C14.9096 34.7416 12.8643 35.0097 10.9447 34.4954C9.02506 33.9811 7.38785 32.7263 6.39227 31.0064ZM4.29707 13.6194C5.17156 12.0998 6.55279 10.9364 8.19885 10.3327C8.19885 10.4013 8.19491 10.5228 8.19491 10.6071V19.808C8.19351 20.0378 8.25334 20.2638 8.36823 20.4629C8.48312 20.6619 8.64893 20.8267 8.84863 20.9404L18.5723 26.5542L15.206 28.4979C15.1894 28.5089 15.1703 28.5155 15.1505 28.5173C15.1307 28.5191 15.1107 28.516 15.0924 28.5082L7.04046 23.8557C5.32135 22.8601 4.06716 21.2235 3.55289 19.3046C3.03862 17.3858 3.30624 15.3413 4.29707 13.6194ZM31.955 20.0556L22.2312 14.4411L25.5976 12.4981C25.6142 12.4872 25.6333 12.4805 25.6531 12.4787C25.6729 12.4769 25.6928 12.4801 25.7111 12.4879L33.7631 17.1364C34.9967 17.849 36.0017 18.8982 36.6606 20.1613C37.3194 21.4244 37.6047 22.849 37.4832 24.2684C37.3617 25.6878 36.8382 27.0432 35.9743 28.1759C35.1103 29.3086 33.9415 30.1717 32.6047 30.6641C32.6047 30.5947 32.6047 30.4733 32.6047 30.3889V21.188C32.6066 20.9586 32.5474 20.7328 32.4332 20.5338C32.319 20.3348 32.154 20.1698 31.955 20.0556ZM35.3055 15.0128C35.2464 14.9765 35.1431 14.9142 35.069 14.8717L27.1045 10.2712C26.906 10.1554 26.6803 10.0943 26.4504 10.0943C26.2206 10.0943 25.9948 10.1554 25.7963 10.2712L16.0726 15.8858V11.9982C16.0715 11.9783 16.0753 11.9585 16.0837 11.9405C16.0921 11.9225 16.1048 11.9068 16.1207 11.8949L24.1719 7.25025C25.4053 6.53903 26.8158 6.19376 28.2383 6.25482C29.6608 6.31589 31.0364 6.78077 32.2044 7.59508C33.3723 8.40939 34.2842 9.53945 34.8334 10.8531C35.3826 12.1667 35.5464 13.6095 35.3055 15.0128ZM14.2424 21.9419L10.8752 19.9981C10.8576 19.9893 10.8423 19.9763 10.8309 19.9602C10.8195 19.9441 10.8122 19.9254 10.8098 19.9058V10.6071C10.8107 9.18295 11.2173 7.78848 11.9819 6.58696C12.7466 5.38544 13.8377 4.42659 15.1275 3.82264C16.4173 3.21869 17.8524 2.99464 19.2649 3.1767C20.6775 3.35876 22.0089 3.93941 23.1034 4.85067C23.0427 4.88379 22.937 4.94215 22.8668 4.98473L14.9024 9.58517C14.7025 9.69878 14.5366 9.86356 14.4215 10.0626C14.3065 10.2616 14.2466 10.4877 14.2479 10.7175L14.2424 21.9419ZM16.071 17.9991L20.4018 15.4978L24.7325 17.9975V22.9985L20.4018 25.4983L16.071 22.9985V17.9991Z" fill="currentColor"></path></svg></div><div class="text-xs flex items-center justify-center gap-1 absolute left-0 -translate-x-full top-2 -ml-4 invisible group-hover:visible"><button class="dark:text-white disabled:text-gray-300 dark:disabled:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="1.5" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-3 h-3" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><polyline points="15 18 9 12 15 6"></polyline></svg></button><span class="flex-grow flex-shrink-0">2 / 2</span><button class="dark:text-white disabled:text-gray-300 dark:disabled:text-gray-400" disabled="disabled"><svg stroke="currentColor" fill="none" stroke-width="1.5" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-3 h-3" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><polyline points="9 18 15 12 9 6"></polyline></svg></button></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4"><div class="request-:R2d6:-8 markdown prose dark:prose-invert break-words dark"><p>Here
is a simple example of a program that can translate a sequence of
nucleotides (either DNA or RNA) into the corresponding sequence of amino
acids:</p><pre><div class="bg-black"><div class="flex items-center relative text-gray-200 bg-gray-800 px-4 py-2 text-xs font-sans"><button class="flex ml-auto gap-2"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M16 4h2a2 2 0 0 1 2 2v14a2 2 0 0 1-2 2H6a2 2 0 0 1-2-2V6a2 2 0 0 1 2-2h2"></path><rect x="8" y="2" width="8" height="4" rx="1" ry="1"></rect></svg>Copy code</button></div><div class="p-4"><code class="!whitespace-pre-wrap hljs language-python"><span class="hljs-comment"># define a function to translate a nucleotide sequence into an amino acid sequence</span>
<span class="hljs-keyword">def</span> <span class="hljs-title function_">translate_nucleotides</span>(<span class="hljs-params">nucleotide_sequence</span>):
<span class="hljs-comment"># create a dictionary to store the codon for each amino acid</span>
codon_table = {
<span class="hljs-string">'ATA'</span>: <span class="hljs-string">'I'</span>, <span class="hljs-string">'ATC'</span>: <span class="hljs-string">'I'</span>, <span class="hljs-string">'ATT'</span>: <span class="hljs-string">'I'</span>, <span class="hljs-string">'ATG'</span>: <span class="hljs-string">'M'</span>,
<span class="hljs-string">'ACA'</span>: <span class="hljs-string">'T'</span>, <span class="hljs-string">'ACC'</span>: <span class="hljs-string">'T'</span>, <span class="hljs-string">'ACG'</span>: <span class="hljs-string">'T'</span>, <span class="hljs-string">'ACT'</span>: <span class="hljs-string">'T'</span>,
<span class="hljs-string">'AAC'</span>: <span class="hljs-string">'N'</span>, <span class="hljs-string">'AAT'</span>: <span class="hljs-string">'N'</span>, <span class="hljs-string">'AAA'</span>: <span class="hljs-string">'K'</span>, <span class="hljs-string">'AAG'</span>: <span class="hljs-string">'K'</span>,
<span class="hljs-string">'AGC'</span>: <span class="hljs-string">'S'</span>, <span class="hljs-string">'AGT'</span>: <span class="hljs-string">'S'</span>, <span class="hljs-string">'AGA'</span>: <span class="hljs-string">'R'</span>, <span class="hljs-string">'AGG'</span>: <span class="hljs-string">'R'</span>,
<span class="hljs-string">'CTA'</span>: <span class="hljs-string">'L'</span>, <span class="hljs-string">'CTC'</span>: <span class="hljs-string">'L'</span>, <span class="hljs-string">'CTG'</span>: <span class="hljs-string">'L'</span>, <span class="hljs-string">'CTT'</span>: <span class="hljs-string">'L'</span>,
<span class="hljs-string">'CCA'</span>: <span class="hljs-string">'P'</span>, <span class="hljs-string">'CCC'</span>: <span class="hljs-string">'P'</span>, <span class="hljs-string">'CCG'</span>: <span class="hljs-string">'P'</span>, <span class="hljs-string">'CCT'</span>: <span class="hljs-string">'P'</span>,
<span class="hljs-string">'CAC'</span>: <span class="hljs-string">'H'</span>, <span class="hljs-string">'CAT'</span>: <span class="hljs-string">'H'</span>, <span class="hljs-string">'CAA'</span>: <span class="hljs-string">'Q'</span>, <span class="hljs-string">'CAG'</span>: <span class="hljs-string">'Q'</span>,
<span class="hljs-string">'CGA'</span>: <span class="hljs-string">'R'</span>, <span class="hljs-string">'CGC'</span>: <span class="hljs-string">'R'</span>, <span class="hljs-string">'CGG'</span>: <span class="hljs-string">'R'</span>, <span class="hljs-string">'CGT'</span>: <span class="hljs-string">'R'</span>,
<span class="hljs-string">'GTA'</span>: <span class="hljs-string">'V'</span>, <span class="hljs-string">'GTC'</span>: <span class="hljs-string">'V'</span>, <span class="hljs-string">'GTG'</span>: <span class="hljs-string">'V'</span>, <span class="hljs-string">'GTT'</span>: <span class="hljs-string">'V'</span>,
<span class="hljs-string">'GCA'</span>: <span class="hljs-string">'A'</span>, <span class="hljs-string">'GCC'</span>: <span class="hljs-string">'A'</span>, <span class="hljs-string">'GCG'</span>: <span class="hljs-string">'A'</span>, <span class="hljs-string">'GCT'</span>: <span class="hljs-string">'A'</span>,
<span class="hljs-string">'GAC'</span>: <span class="hljs-string">'D'</span>, <span class="hljs-string">'GAT'</span>: <span class="hljs-string">'D'</span>, <span class="hljs-string">'GAA'</span>: <span class="hljs-string">'E'</span>, <span class="hljs-string">'GAG'</span>: <span class="hljs-string">'E'</span>,
<span class="hljs-string">'GGA'</span>: <span class="hljs-string">'G'</span>, <span class="hljs-string">'GGC'</span>: <span class="hljs-string">'G'</span>, <span class="hljs-string">'GGG'</span>: <span class="hljs-string">'G'</span>, <span class="hljs-string">'GGT'</span>: <span class="hljs-string">'G'</span>,
<span class="hljs-string">'TCA'</span>: <span class="hljs-string">'S'</span>, <span class="hljs-string">'TCC'</span>: <span class="hljs-string">'S'</span>, <span class="hljs-string">'TCG'</span>: <span class="hljs-string">'S'</span>, <span class="hljs-string">'TCT'</span>: <span class="hljs-string">'S'</span>,
<span class="hljs-string">'TTC'</span>: <span class="hljs-string">'F'</span>, <span class="hljs-string">'TTT'</span>: <span class="hljs-string">'F'</span>, <span class="hljs-string">'TTA'</span>: <span class="hljs-string">'L'</span>, <span class="hljs-string">'TTG'</span>: <span class="hljs-string">'L'</span>,
<span class="hljs-string">'TAC'</span>: <span class="hljs-string">'Y'</span>, <span class="hljs-string">'TAT'</span>: <span class="hljs-string">'Y'</span>, <span class="hljs-string">'TAA'</span>: <span class="hljs-string">'_'</span>, <span class="hljs-string">'TAG'</span>: <span class="hljs-string">'_'</span>,
<span class="hljs-string">'TGC'</span>: <span class="hljs-string">'C'</span>, <span class="hljs-string">'TGT'</span>: <span class="hljs-string">'C'</span>, <span class="hljs-string">'TGA'</span>: <span class="hljs-string">'_'</span>, <span class="hljs-string">'TGG'</span>: <span class="hljs-string">'W'</span>
}
<span class="hljs-comment"># initialize an empty string to store the amino acid sequence</span>
amino_acid_sequence = <span class="hljs-string">""</span>
<span class="hljs-comment"># iterate over the nucleotides in the nucleotide sequence in groups of three</span>
<span class="hljs-keyword">for</span> i <span class="hljs-keyword">in</span> <span class="hljs-built_in">range</span>(<span class="hljs-number">0</span>, <span class="hljs-built_in">len</span>(nucleotide_sequence), <span class="hljs-number">3</span>):
<span class="hljs-comment"># get the current codon from the nucleotide sequence</span>
codon = nucleotide_sequence[i:i + <span class="hljs-number">3</span>]
<span class="hljs-comment"># add the corresponding amino acid to the amino acid sequence string</span>
amino_acid_sequence += codon_table[codon]
<span class="hljs-comment"># return the amino acid sequence</span>
<span class="hljs-keyword">return</span> amino_acid_sequence
<span class="hljs-comment"># test the function with a sample nucleotide sequence</span>
nucleotide_sequence = <span class="hljs-string">"ATCGAGTCGATCGTAGCTAGCTAGCTAGCTAGCTACGTAGCTACGATCG"</span>
<span class="hljs-built_in">print</span>(translate_nucleotides(nucleotide_sequence))
</code></div></div></pre></div></div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M14 9V5a3 3 0 0 0-3-3l-4 9v11h11.28a2 2 0 0 0 2-1.7l1.38-9a2 2 0 0 0-2-2.3zM7 22H4a2 2 0 0 1-2-2v-7a2 2 0 0 1 2-2h3"></path></svg></button><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M10 15v4a3 3 0 0 0 3 3l4-9V2H5.72a2 2 0 0 0-2 1.7l-1.38 9a2 2 0 0 0 2 2.3zm7-13h2.67A2.31 2.31 0 0 1 22 4v7a2.31 2.31 0 0 1-2.33 2H17"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group dark:bg-gray-800"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative flex"><span style="box-sizing: border-box; display: inline-block; overflow: hidden; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; position: relative; max-width: 100%;"><span style="box-sizing: border-box; display: block; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; max-width: 100%;"><img alt="" aria-hidden="true" src="data:image/svg+xml,%3csvg%20xmlns=%27http://www.w3.org/2000/svg%27%20version=%271.1%27%20width=%2730%27%20height=%2730%27/%3e" style="display: block; max-width: 100%; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px;"></span><img alt="Félix" srcset="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=32&amp;q=75 1x, /_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75 2x" src="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75" decoding="async" data-nimg="intrinsic" class="rounded-sm" style="position: absolute; inset: 0px; box-sizing: border-box; padding: 0px; border: none; margin: auto; display: block; width: 0px; height: 0px; min-width: 100%; max-width: 100%; min-height: 100%; max-height: 100%;"></span></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4">Generate the code to translate RNA into a proteins</div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M11 4H4a2 2 0 0 0-2 2v14a2 2 0 0 0 2 2h14a2 2 0 0 0 2-2v-7"></path><path d="M18.5 2.5a2.121 2.121 0 0 1 3 3L12 15l-4 1 1-4 9.5-9.5z"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group bg-gray-50 dark:bg-[#444654]"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative h-[30px] w-[30px] p-1 rounded-sm text-white flex items-center justify-center" style="background-color: rgb(16, 163, 127);"><svg width="41" height="41" viewBox="0 0 41 41" fill="none" xmlns="http://www.w3.org/2000/svg" stroke-width="1.5" class="w-6 h-6"><path d="M37.5324 16.8707C37.9808 15.5241 38.1363 14.0974 37.9886 12.6859C37.8409 11.2744 37.3934 9.91076 36.676 8.68622C35.6126 6.83404 33.9882 5.3676 32.0373 4.4985C30.0864 3.62941 27.9098 3.40259 25.8215 3.85078C24.8796 2.7893 23.7219 1.94125 22.4257 1.36341C21.1295 0.785575 19.7249 0.491269 18.3058 0.500197C16.1708 0.495044 14.0893 1.16803 12.3614 2.42214C10.6335 3.67624 9.34853 5.44666 8.6917 7.47815C7.30085 7.76286 5.98686 8.3414 4.8377 9.17505C3.68854 10.0087 2.73073 11.0782 2.02839 12.312C0.956464 14.1591 0.498905 16.2988 0.721698 18.4228C0.944492 20.5467 1.83612 22.5449 3.268 24.1293C2.81966 25.4759 2.66413 26.9026 2.81182 28.3141C2.95951 29.7256 3.40701 31.0892 4.12437 32.3138C5.18791 34.1659 6.8123 35.6322 8.76321 36.5013C10.7141 37.3704 12.8907 37.5973 14.9789 37.1492C15.9208 38.2107 17.0786 39.0587 18.3747 39.6366C19.6709 40.2144 21.0755 40.5087 22.4946 40.4998C24.6307 40.5054 26.7133 39.8321 28.4418 38.5772C30.1704 37.3223 31.4556 35.5506 32.1119 33.5179C33.5027 33.2332 34.8167 32.6547 35.9659 31.821C37.115 30.9874 38.0728 29.9178 38.7752 28.684C39.8458 26.8371 40.3023 24.6979 40.0789 22.5748C39.8556 20.4517 38.9639 18.4544 37.5324 16.8707ZM22.4978 37.8849C20.7443 37.8874 19.0459 37.2733 17.6994 36.1501C17.7601 36.117 17.8666 36.0586 17.936 36.0161L25.9004 31.4156C26.1003 31.3019 26.2663 31.137 26.3813 30.9378C26.4964 30.7386 26.5563 30.5124 26.5549 30.2825V19.0542L29.9213 20.998C29.9389 21.0068 29.9541 21.0198 29.9656 21.0359C29.977 21.052 29.9842 21.0707 29.9867 21.0902V30.3889C29.9842 32.375 29.1946 34.2791 27.7909 35.6841C26.3872 37.0892 24.4838 37.8806 22.4978 37.8849ZM6.39227 31.0064C5.51397 29.4888 5.19742 27.7107 5.49804 25.9832C5.55718 26.0187 5.66048 26.0818 5.73461 26.1244L13.699 30.7248C13.8975 30.8408 14.1233 30.902 14.3532 30.902C14.583 30.902 14.8088 30.8408 15.0073 30.7248L24.731 25.1103V28.9979C24.7321 29.0177 24.7283 29.0376 24.7199 29.0556C24.7115 29.0736 24.6988 29.0893 24.6829 29.1012L16.6317 33.7497C14.9096 34.7416 12.8643 35.0097 10.9447 34.4954C9.02506 33.9811 7.38785 32.7263 6.39227 31.0064ZM4.29707 13.6194C5.17156 12.0998 6.55279 10.9364 8.19885 10.3327C8.19885 10.4013 8.19491 10.5228 8.19491 10.6071V19.808C8.19351 20.0378 8.25334 20.2638 8.36823 20.4629C8.48312 20.6619 8.64893 20.8267 8.84863 20.9404L18.5723 26.5542L15.206 28.4979C15.1894 28.5089 15.1703 28.5155 15.1505 28.5173C15.1307 28.5191 15.1107 28.516 15.0924 28.5082L7.04046 23.8557C5.32135 22.8601 4.06716 21.2235 3.55289 19.3046C3.03862 17.3858 3.30624 15.3413 4.29707 13.6194ZM31.955 20.0556L22.2312 14.4411L25.5976 12.4981C25.6142 12.4872 25.6333 12.4805 25.6531 12.4787C25.6729 12.4769 25.6928 12.4801 25.7111 12.4879L33.7631 17.1364C34.9967 17.849 36.0017 18.8982 36.6606 20.1613C37.3194 21.4244 37.6047 22.849 37.4832 24.2684C37.3617 25.6878 36.8382 27.0432 35.9743 28.1759C35.1103 29.3086 33.9415 30.1717 32.6047 30.6641C32.6047 30.5947 32.6047 30.4733 32.6047 30.3889V21.188C32.6066 20.9586 32.5474 20.7328 32.4332 20.5338C32.319 20.3348 32.154 20.1698 31.955 20.0556ZM35.3055 15.0128C35.2464 14.9765 35.1431 14.9142 35.069 14.8717L27.1045 10.2712C26.906 10.1554 26.6803 10.0943 26.4504 10.0943C26.2206 10.0943 25.9948 10.1554 25.7963 10.2712L16.0726 15.8858V11.9982C16.0715 11.9783 16.0753 11.9585 16.0837 11.9405C16.0921 11.9225 16.1048 11.9068 16.1207 11.8949L24.1719 7.25025C25.4053 6.53903 26.8158 6.19376 28.2383 6.25482C29.6608 6.31589 31.0364 6.78077 32.2044 7.59508C33.3723 8.40939 34.2842 9.53945 34.8334 10.8531C35.3826 12.1667 35.5464 13.6095 35.3055 15.0128ZM14.2424 21.9419L10.8752 19.9981C10.8576 19.9893 10.8423 19.9763 10.8309 19.9602C10.8195 19.9441 10.8122 19.9254 10.8098 19.9058V10.6071C10.8107 9.18295 11.2173 7.78848 11.9819 6.58696C12.7466 5.38544 13.8377 4.42659 15.1275 3.82264C16.4173 3.21869 17.8524 2.99464 19.2649 3.1767C20.6775 3.35876 22.0089 3.93941 23.1034 4.85067C23.0427 4.88379 22.937 4.94215 22.8668 4.98473L14.9024 9.58517C14.7025 9.69878 14.5366 9.86356 14.4215 10.0626C14.3065 10.2616 14.2466 10.4877 14.2479 10.7175L14.2424 21.9419ZM16.071 17.9991L20.4018 15.4978L24.7325 17.9975V22.9985L20.4018 25.4983L16.071 22.9985V17.9991Z" fill="currentColor"></path></svg></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4"><div class="request-:R2d6:-9 markdown prose dark:prose-invert break-words dark"><p>Here is a simple example of a program that can translate an RNA sequence into the corresponding protein:</p><pre><div class="bg-black"><div class="flex items-center relative text-gray-200 bg-gray-800 px-4 py-2 text-xs font-sans"><button class="flex ml-auto gap-2"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M16 4h2a2 2 0 0 1 2 2v14a2 2 0 0 1-2 2H6a2 2 0 0 1-2-2V6a2 2 0 0 1 2-2h2"></path><rect x="8" y="2" width="8" height="4" rx="1" ry="1"></rect></svg>Copy code</button></div><div class="p-4"><code class="!whitespace-pre-wrap hljs language-python"><span class="hljs-comment"># define a function to translate an RNA sequence into a protein</span>
<span class="hljs-keyword">def</span> <span class="hljs-title function_">translate_rna</span>(<span class="hljs-params">rna_sequence</span>):
<span class="hljs-comment"># create a dictionary to store the codon for each amino acid</span>
codon_table = {
<span class="hljs-string">'AUG'</span>: <span class="hljs-string">'M'</span>,
<span class="hljs-string">'UUU'</span>: <span class="hljs-string">'F'</span>, <span class="hljs-string">'UUC'</span>: <span class="hljs-string">'F'</span>,
<span class="hljs-string">'UUA'</span>: <span class="hljs-string">'L'</span>, <span class="hljs-string">'UUG'</span>: <span class="hljs-string">'L'</span>,
<span class="hljs-string">'UCU'</span>: <span class="hljs-string">'S'</span>, <span class="hljs-string">'UCC'</span>: <span class="hljs-string">'S'</span>, <span class="hljs-string">'UCA'</span>: <span class="hljs-string">'S'</span>, <span class="hljs-string">'UCG'</span>: <span class="hljs-string">'S'</span>,
<span class="hljs-string">'UAU'</span>: <span class="hljs-string">'Y'</span>, <span class="hljs-string">'UAC'</span>: <span class="hljs-string">'Y'</span>,
<span class="hljs-string">'UAA'</span>: <span class="hljs-string">'_'</span>, <span class="hljs-string">'UAG'</span>: <span class="hljs-string">'_'</span>, <span class="hljs-string">'UGA'</span>: <span class="hljs-string">'_'</span>,
<span class="hljs-string">'UGU'</span>: <span class="hljs-string">'C'</span>, <span class="hljs-string">'UGC'</span>: <span class="hljs-string">'C'</span>,
<span class="hljs-string">'UGG'</span>: <span class="hljs-string">'W'</span>,
<span class="hljs-string">'CUU'</span>: <span class="hljs-string">'L'</span>, <span class="hljs-string">'CUC'</span>: <span class="hljs-string">'L'</span>, <span class="hljs-string">'CUA'</span>: <span class="hljs-string">'L'</span>, <span class="hljs-string">'CUG'</span>: <span class="hljs-string">'L'</span>,
<span class="hljs-string">'CCU'</span>: <span class="hljs-string">'P'</span>, <span class="hljs-string">'CCC'</span>: <span class="hljs-string">'P'</span>, <span class="hljs-string">'CCA'</span>: <span class="hljs-string">'P'</span>, <span class="hljs-string">'CCG'</span>: <span class="hljs-string">'P'</span>,
<span class="hljs-string">'CAU'</span>: <span class="hljs-string">'H'</span>, <span class="hljs-string">'CAC'</span>: <span class="hljs-string">'H'</span>,
<span class="hljs-string">'CAA'</span>: <span class="hljs-string">'Q'</span>, <span class="hljs-string">'CAG'</span>: <span class="hljs-string">'Q'</span>,
<span class="hljs-string">'CGU'</span>: <span class="hljs-string">'R'</span>, <span class="hljs-string">'CGC'</span>: <span class="hljs-string">'R'</span>, <span class="hljs-string">'CGA'</span>: <span class="hljs-string">'R'</span>, <span class="hljs-string">'CGG'</span>: <span class="hljs-string">'R'</span>,
<span class="hljs-string">'AUU'</span>: <span class="hljs-string">'I'</span>, <span class="hljs-string">'AUC'</span>: <span class="hljs-string">'I'</span>, <span class="hljs-string">'AUA'</span>: <span class="hljs-string">'I'</span>,
<span class="hljs-string">'AUG'</span>: <span class="hljs-string">'M'</span>,
<span class="hljs-string">'ACU'</span>: <span class="hljs-string">'T'</span>, <span class="hljs-string">'ACC'</span>: <span class="hljs-string">'T'</span>, <span class="hljs-string">'ACA'</span>: <span class="hljs-string">'T'</span>, <span class="hljs-string">'ACG'</span>: <span class="hljs-string">'T'</span>,
<span class="hljs-string">'AAU'</span>: <span class="hljs-string">'N'</span>, <span class="hljs-string">'AAC'</span>: <span class="hljs-string">'N'</span>,
<span class="hljs-string">'AAA'</span>: <span class="hljs-string">'K'</span>, <span class="hljs-string">'AAG'</span>: <span class="hljs-string">'K'</span>,
<span class="hljs-string">'AGU'</span>: <span class="hljs-string">'S'</span>, <span class="hljs-string">'AGC'</span>: <span class="hljs-string">'S'</span>,
<span class="hljs-string">'AGA'</span>: <span class="hljs-string">'R'</span>, <span class="hljs-string">'AGG'</span>: <span class="hljs-string">'R'</span>,
<span class="hljs-string">'GUU'</span>: <span class="hljs-string">'V'</span>, <span class="hljs-string">'GUC'</span>: <span class="hljs-string">'V'</span>, <span class="hljs-string">'GUA'</span>: <span class="hljs-string">'V'</span>, <span class="hljs-string">'GUG'</span>: <span class="hljs-string">'V'</span>,
<span class="hljs-string">'GCU'</span>: <span class="hljs-string">'A'</span>, <span class="hljs-string">'GCC'</span>: <span class="hljs-string">'A'</span>, <span class="hljs-string">'GCA'</span>: <span class="hljs-string">'A'</span>, <span class="hljs-string">'GCG'</span>: <span class="hljs-string">'A'</span>,
<span class="hljs-string">'GAU'</span>: <span class="hljs-string">'D'</span>, <span class="hljs-string">'GAC'</span>: <span class="hljs-string">'D'</span>,
<span class="hljs-string">'GAA'</span>: <span class="hljs-string">'E'</span>, <span class="hljs-string">'GAG'</span>: <span class="hljs-string">'E'</span>,
<span class="hljs-string">'GGU'</span>: <span class="hljs-string">'G'</span>, <span class="hljs-string">'GGC'</span>: <span class="hljs-string">'G'</span>, <span class="hljs-string">'GGA'</span>: <span class="hljs-string">'G'</span>, <span class="hljs-string">'GGG'</span>: <span class="hljs-string">'G'</span>
}
<span class="hljs-comment"># initialize an empty string to store the protein sequence</span>
protein_sequence = <span class="hljs-string">""</span>
<span class="hljs-comment"># iterate over the nucleotides in the RNA sequence in groups of three</span>
<span class="hljs-keyword">for</span> i <span class="hljs-keyword">in</span> <span class="hljs-built_in">range</span>(<span class="hljs-number">0</span>, <span class="hljs-built_in">len</span>(rna_sequence), <span class="hljs-number">3</span>):
<span class="hljs-comment"># get the current codon from the RNA sequence</span>
codon = rna_sequence[i:i + <span class="hljs-number">3</span>]
<span class="hljs-comment"># add the corresponding amino acid to the protein sequence string</span>
protein_sequence += codon_table[codon]
<span class="hljs-comment"># return the protein sequence</span>
<span class="hljs-keyword">return</span> protein_sequence
<span class="hljs-comment"># test the function with a sample RNA sequence</span>
rna_sequence = <span class="hljs-string">"AUGAGUAAAUAGCGAUCAGCGAUCAGUGACGAUCGAUCAGUCGAUCAGU"</span>
<span class="hljs-built_in">print</span>(translate_rna(rna_sequence))
</code></div></div></pre><p>In this code, the</p></div></div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M14 9V5a3 3 0 0 0-3-3l-4 9v11h11.28a2 2 0 0 0 2-1.7l1.38-9a2 2 0 0 0-2-2.3zM7 22H4a2 2 0 0 1-2-2v-7a2 2 0 0 1 2-2h3"></path></svg></button><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M10 15v4a3 3 0 0 0 3 3l4-9V2H5.72a2 2 0 0 0-2 1.7l-1.38 9a2 2 0 0 0 2 2.3zm7-13h2.67A2.31 2.31 0 0 1 22 4v7a2.31 2.31 0 0 1-2.33 2H17"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group dark:bg-gray-800"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative flex"><span style="box-sizing: border-box; display: inline-block; overflow: hidden; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; position: relative; max-width: 100%;"><span style="box-sizing: border-box; display: block; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; max-width: 100%;"><img alt="" aria-hidden="true" src="data:image/svg+xml,%3csvg%20xmlns=%27http://www.w3.org/2000/svg%27%20version=%271.1%27%20width=%2730%27%20height=%2730%27/%3e" style="display: block; max-width: 100%; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px;"></span><img alt="Félix" srcset="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=32&amp;q=75 1x, /_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75 2x" src="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75" decoding="async" data-nimg="intrinsic" class="rounded-sm" style="position: absolute; inset: 0px; box-sizing: border-box; padding: 0px; border: none; margin: auto; display: block; width: 0px; height: 0px; min-width: 100%; max-width: 100%; min-height: 100%; max-height: 100%;"></span></div><div class="text-xs flex items-center justify-center gap-1 absolute left-0 -translate-x-full top-2 -ml-4 invisible group-hover:visible"><button class="dark:text-white disabled:text-gray-300 dark:disabled:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="1.5" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-3 h-3" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><polyline points="15 18 9 12 15 6"></polyline></svg></button><span class="flex-grow flex-shrink-0">2 / 2</span><button disabled="disabled" class="dark:text-white disabled:text-gray-300 dark:disabled:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="1.5" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-3 h-3" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><polyline points="9 18 15 12 9 6"></polyline></svg></button></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4">Generate the code that simulate the protein's three-dimensional structure and function from a protein sequence</div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M11 4H4a2 2 0 0 0-2 2v14a2 2 0 0 0 2 2h14a2 2 0 0 0 2-2v-7"></path><path d="M18.5 2.5a2.121 2.121 0 0 1 3 3L12 15l-4 1 1-4 9.5-9.5z"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group bg-gray-50 dark:bg-[#444654]"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative h-[30px] w-[30px] p-1 rounded-sm text-white flex items-center justify-center" style="background-color: rgb(16, 163, 127);"><svg width="41" height="41" viewBox="0 0 41 41" fill="none" xmlns="http://www.w3.org/2000/svg" stroke-width="1.5" class="w-6 h-6"><path d="M37.5324 16.8707C37.9808 15.5241 38.1363 14.0974 37.9886 12.6859C37.8409 11.2744 37.3934 9.91076 36.676 8.68622C35.6126 6.83404 33.9882 5.3676 32.0373 4.4985C30.0864 3.62941 27.9098 3.40259 25.8215 3.85078C24.8796 2.7893 23.7219 1.94125 22.4257 1.36341C21.1295 0.785575 19.7249 0.491269 18.3058 0.500197C16.1708 0.495044 14.0893 1.16803 12.3614 2.42214C10.6335 3.67624 9.34853 5.44666 8.6917 7.47815C7.30085 7.76286 5.98686 8.3414 4.8377 9.17505C3.68854 10.0087 2.73073 11.0782 2.02839 12.312C0.956464 14.1591 0.498905 16.2988 0.721698 18.4228C0.944492 20.5467 1.83612 22.5449 3.268 24.1293C2.81966 25.4759 2.66413 26.9026 2.81182 28.3141C2.95951 29.7256 3.40701 31.0892 4.12437 32.3138C5.18791 34.1659 6.8123 35.6322 8.76321 36.5013C10.7141 37.3704 12.8907 37.5973 14.9789 37.1492C15.9208 38.2107 17.0786 39.0587 18.3747 39.6366C19.6709 40.2144 21.0755 40.5087 22.4946 40.4998C24.6307 40.5054 26.7133 39.8321 28.4418 38.5772C30.1704 37.3223 31.4556 35.5506 32.1119 33.5179C33.5027 33.2332 34.8167 32.6547 35.9659 31.821C37.115 30.9874 38.0728 29.9178 38.7752 28.684C39.8458 26.8371 40.3023 24.6979 40.0789 22.5748C39.8556 20.4517 38.9639 18.4544 37.5324 16.8707ZM22.4978 37.8849C20.7443 37.8874 19.0459 37.2733 17.6994 36.1501C17.7601 36.117 17.8666 36.0586 17.936 36.0161L25.9004 31.4156C26.1003 31.3019 26.2663 31.137 26.3813 30.9378C26.4964 30.7386 26.5563 30.5124 26.5549 30.2825V19.0542L29.9213 20.998C29.9389 21.0068 29.9541 21.0198 29.9656 21.0359C29.977 21.052 29.9842 21.0707 29.9867 21.0902V30.3889C29.9842 32.375 29.1946 34.2791 27.7909 35.6841C26.3872 37.0892 24.4838 37.8806 22.4978 37.8849ZM6.39227 31.0064C5.51397 29.4888 5.19742 27.7107 5.49804 25.9832C5.55718 26.0187 5.66048 26.0818 5.73461 26.1244L13.699 30.7248C13.8975 30.8408 14.1233 30.902 14.3532 30.902C14.583 30.902 14.8088 30.8408 15.0073 30.7248L24.731 25.1103V28.9979C24.7321 29.0177 24.7283 29.0376 24.7199 29.0556C24.7115 29.0736 24.6988 29.0893 24.6829 29.1012L16.6317 33.7497C14.9096 34.7416 12.8643 35.0097 10.9447 34.4954C9.02506 33.9811 7.38785 32.7263 6.39227 31.0064ZM4.29707 13.6194C5.17156 12.0998 6.55279 10.9364 8.19885 10.3327C8.19885 10.4013 8.19491 10.5228 8.19491 10.6071V19.808C8.19351 20.0378 8.25334 20.2638 8.36823 20.4629C8.48312 20.6619 8.64893 20.8267 8.84863 20.9404L18.5723 26.5542L15.206 28.4979C15.1894 28.5089 15.1703 28.5155 15.1505 28.5173C15.1307 28.5191 15.1107 28.516 15.0924 28.5082L7.04046 23.8557C5.32135 22.8601 4.06716 21.2235 3.55289 19.3046C3.03862 17.3858 3.30624 15.3413 4.29707 13.6194ZM31.955 20.0556L22.2312 14.4411L25.5976 12.4981C25.6142 12.4872 25.6333 12.4805 25.6531 12.4787C25.6729 12.4769 25.6928 12.4801 25.7111 12.4879L33.7631 17.1364C34.9967 17.849 36.0017 18.8982 36.6606 20.1613C37.3194 21.4244 37.6047 22.849 37.4832 24.2684C37.3617 25.6878 36.8382 27.0432 35.9743 28.1759C35.1103 29.3086 33.9415 30.1717 32.6047 30.6641C32.6047 30.5947 32.6047 30.4733 32.6047 30.3889V21.188C32.6066 20.9586 32.5474 20.7328 32.4332 20.5338C32.319 20.3348 32.154 20.1698 31.955 20.0556ZM35.3055 15.0128C35.2464 14.9765 35.1431 14.9142 35.069 14.8717L27.1045 10.2712C26.906 10.1554 26.6803 10.0943 26.4504 10.0943C26.2206 10.0943 25.9948 10.1554 25.7963 10.2712L16.0726 15.8858V11.9982C16.0715 11.9783 16.0753 11.9585 16.0837 11.9405C16.0921 11.9225 16.1048 11.9068 16.1207 11.8949L24.1719 7.25025C25.4053 6.53903 26.8158 6.19376 28.2383 6.25482C29.6608 6.31589 31.0364 6.78077 32.2044 7.59508C33.3723 8.40939 34.2842 9.53945 34.8334 10.8531C35.3826 12.1667 35.5464 13.6095 35.3055 15.0128ZM14.2424 21.9419L10.8752 19.9981C10.8576 19.9893 10.8423 19.9763 10.8309 19.9602C10.8195 19.9441 10.8122 19.9254 10.8098 19.9058V10.6071C10.8107 9.18295 11.2173 7.78848 11.9819 6.58696C12.7466 5.38544 13.8377 4.42659 15.1275 3.82264C16.4173 3.21869 17.8524 2.99464 19.2649 3.1767C20.6775 3.35876 22.0089 3.93941 23.1034 4.85067C23.0427 4.88379 22.937 4.94215 22.8668 4.98473L14.9024 9.58517C14.7025 9.69878 14.5366 9.86356 14.4215 10.0626C14.3065 10.2616 14.2466 10.4877 14.2479 10.7175L14.2424 21.9419ZM16.071 17.9991L20.4018 15.4978L24.7325 17.9975V22.9985L20.4018 25.4983L16.071 22.9985V17.9991Z" fill="currentColor"></path></svg></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4"><div class="request-:R2d6:-11 markdown prose dark:prose-invert break-words dark"><p>It
is currently not possible to generate code that can simulate the
three-dimensional structure and function of a protein from its amino
acid sequence. Protein folding and function is a very complex process
that is not well understood, and it is difficult to predict the
three-dimensional structure and function of a protein from its amino
acid sequence alone.</p><p>Proteins are made up of long chains of amino
acids that fold into specific three-dimensional shapes. These shapes
determine the protein's function, which can be very diverse, from
catalyzing chemical reactions to providing structural support to cells.
The process of protein folding is influenced by many factors, including
the amino acid sequence, the environment, and interactions with other
molecules.</p><p>Predicting the three-dimensional structure and function
of a protein from its amino acid sequence is an active area of
research, and there are many different approaches and techniques that
are being developed to better understand this process. However, it is
currently not possible to generate code that can accurately simulate the
three-dimensional structure and function of a protein from its amino
acid sequence.</p></div></div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M14 9V5a3 3 0 0 0-3-3l-4 9v11h11.28a2 2 0 0 0 2-1.7l1.38-9a2 2 0 0 0-2-2.3zM7 22H4a2 2 0 0 1-2-2v-7a2 2 0 0 1 2-2h3"></path></svg></button><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M10 15v4a3 3 0 0 0 3 3l4-9V2H5.72a2 2 0 0 0-2 1.7l-1.38 9a2 2 0 0 0 2 2.3zm7-13h2.67A2.31 2.31 0 0 1 22 4v7a2.31 2.31 0 0 1-2.33 2H17"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group dark:bg-gray-800"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative flex"><span style="box-sizing: border-box; display: inline-block; overflow: hidden; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; position: relative; max-width: 100%;"><span style="box-sizing: border-box; display: block; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px; max-width: 100%;"><img alt="" aria-hidden="true" src="data:image/svg+xml,%3csvg%20xmlns=%27http://www.w3.org/2000/svg%27%20version=%271.1%27%20width=%2730%27%20height=%2730%27/%3e" style="display: block; max-width: 100%; width: initial; height: initial; background: none; opacity: 1; border: 0px; margin: 0px; padding: 0px;"></span><img alt="Félix" srcset="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=32&amp;q=75 1x, /_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75 2x" src="/_next/image?url=https%3A%2F%2Flh3.googleusercontent.com%2Fa%2FAEdFTp4JHdKJ-JbI26wZsSJk25anJ_-on4Nnw-Y1pCedq94%3Ds96-c&amp;w=64&amp;q=75" decoding="async" data-nimg="intrinsic" class="rounded-sm" style="position: absolute; inset: 0px; box-sizing: border-box; padding: 0px; border: none; margin: auto; display: block; width: 0px; height: 0px; min-width: 100%; max-width: 100%; min-height: 100%; max-height: 100%;"></span></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4">What are all the uses of proteins</div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M11 4H4a2 2 0 0 0-2 2v14a2 2 0 0 0 2 2h14a2 2 0 0 0 2-2v-7"></path><path d="M18.5 2.5a2.121 2.121 0 0 1 3 3L12 15l-4 1 1-4 9.5-9.5z"></path></svg></button></div></div></div></div><div class="w-full border-b border-black/10 dark:border-gray-900/50 text-gray-800 dark:text-gray-100 group bg-gray-50 dark:bg-[#444654]"><div class="text-base gap-6 m-auto md:max-w-2xl lg:max-w-2xl xl:max-w-3xl p-4 md:py-6 flex lg:px-0"><div class="w-[30px] flex flex-col relative items-end"><div class="relative h-[30px] w-[30px] p-1 rounded-sm text-white flex items-center justify-center" style="background-color: rgb(16, 163, 127);"><svg width="41" height="41" viewBox="0 0 41 41" fill="none" xmlns="http://www.w3.org/2000/svg" stroke-width="1.5" class="w-6 h-6"><path d="M37.5324 16.8707C37.9808 15.5241 38.1363 14.0974 37.9886 12.6859C37.8409 11.2744 37.3934 9.91076 36.676 8.68622C35.6126 6.83404 33.9882 5.3676 32.0373 4.4985C30.0864 3.62941 27.9098 3.40259 25.8215 3.85078C24.8796 2.7893 23.7219 1.94125 22.4257 1.36341C21.1295 0.785575 19.7249 0.491269 18.3058 0.500197C16.1708 0.495044 14.0893 1.16803 12.3614 2.42214C10.6335 3.67624 9.34853 5.44666 8.6917 7.47815C7.30085 7.76286 5.98686 8.3414 4.8377 9.17505C3.68854 10.0087 2.73073 11.0782 2.02839 12.312C0.956464 14.1591 0.498905 16.2988 0.721698 18.4228C0.944492 20.5467 1.83612 22.5449 3.268 24.1293C2.81966 25.4759 2.66413 26.9026 2.81182 28.3141C2.95951 29.7256 3.40701 31.0892 4.12437 32.3138C5.18791 34.1659 6.8123 35.6322 8.76321 36.5013C10.7141 37.3704 12.8907 37.5973 14.9789 37.1492C15.9208 38.2107 17.0786 39.0587 18.3747 39.6366C19.6709 40.2144 21.0755 40.5087 22.4946 40.4998C24.6307 40.5054 26.7133 39.8321 28.4418 38.5772C30.1704 37.3223 31.4556 35.5506 32.1119 33.5179C33.5027 33.2332 34.8167 32.6547 35.9659 31.821C37.115 30.9874 38.0728 29.9178 38.7752 28.684C39.8458 26.8371 40.3023 24.6979 40.0789 22.5748C39.8556 20.4517 38.9639 18.4544 37.5324 16.8707ZM22.4978 37.8849C20.7443 37.8874 19.0459 37.2733 17.6994 36.1501C17.7601 36.117 17.8666 36.0586 17.936 36.0161L25.9004 31.4156C26.1003 31.3019 26.2663 31.137 26.3813 30.9378C26.4964 30.7386 26.5563 30.5124 26.5549 30.2825V19.0542L29.9213 20.998C29.9389 21.0068 29.9541 21.0198 29.9656 21.0359C29.977 21.052 29.9842 21.0707 29.9867 21.0902V30.3889C29.9842 32.375 29.1946 34.2791 27.7909 35.6841C26.3872 37.0892 24.4838 37.8806 22.4978 37.8849ZM6.39227 31.0064C5.51397 29.4888 5.19742 27.7107 5.49804 25.9832C5.55718 26.0187 5.66048 26.0818 5.73461 26.1244L13.699 30.7248C13.8975 30.8408 14.1233 30.902 14.3532 30.902C14.583 30.902 14.8088 30.8408 15.0073 30.7248L24.731 25.1103V28.9979C24.7321 29.0177 24.7283 29.0376 24.7199 29.0556C24.7115 29.0736 24.6988 29.0893 24.6829 29.1012L16.6317 33.7497C14.9096 34.7416 12.8643 35.0097 10.9447 34.4954C9.02506 33.9811 7.38785 32.7263 6.39227 31.0064ZM4.29707 13.6194C5.17156 12.0998 6.55279 10.9364 8.19885 10.3327C8.19885 10.4013 8.19491 10.5228 8.19491 10.6071V19.808C8.19351 20.0378 8.25334 20.2638 8.36823 20.4629C8.48312 20.6619 8.64893 20.8267 8.84863 20.9404L18.5723 26.5542L15.206 28.4979C15.1894 28.5089 15.1703 28.5155 15.1505 28.5173C15.1307 28.5191 15.1107 28.516 15.0924 28.5082L7.04046 23.8557C5.32135 22.8601 4.06716 21.2235 3.55289 19.3046C3.03862 17.3858 3.30624 15.3413 4.29707 13.6194ZM31.955 20.0556L22.2312 14.4411L25.5976 12.4981C25.6142 12.4872 25.6333 12.4805 25.6531 12.4787C25.6729 12.4769 25.6928 12.4801 25.7111 12.4879L33.7631 17.1364C34.9967 17.849 36.0017 18.8982 36.6606 20.1613C37.3194 21.4244 37.6047 22.849 37.4832 24.2684C37.3617 25.6878 36.8382 27.0432 35.9743 28.1759C35.1103 29.3086 33.9415 30.1717 32.6047 30.6641C32.6047 30.5947 32.6047 30.4733 32.6047 30.3889V21.188C32.6066 20.9586 32.5474 20.7328 32.4332 20.5338C32.319 20.3348 32.154 20.1698 31.955 20.0556ZM35.3055 15.0128C35.2464 14.9765 35.1431 14.9142 35.069 14.8717L27.1045 10.2712C26.906 10.1554 26.6803 10.0943 26.4504 10.0943C26.2206 10.0943 25.9948 10.1554 25.7963 10.2712L16.0726 15.8858V11.9982C16.0715 11.9783 16.0753 11.9585 16.0837 11.9405C16.0921 11.9225 16.1048 11.9068 16.1207 11.8949L24.1719 7.25025C25.4053 6.53903 26.8158 6.19376 28.2383 6.25482C29.6608 6.31589 31.0364 6.78077 32.2044 7.59508C33.3723 8.40939 34.2842 9.53945 34.8334 10.8531C35.3826 12.1667 35.5464 13.6095 35.3055 15.0128ZM14.2424 21.9419L10.8752 19.9981C10.8576 19.9893 10.8423 19.9763 10.8309 19.9602C10.8195 19.9441 10.8122 19.9254 10.8098 19.9058V10.6071C10.8107 9.18295 11.2173 7.78848 11.9819 6.58696C12.7466 5.38544 13.8377 4.42659 15.1275 3.82264C16.4173 3.21869 17.8524 2.99464 19.2649 3.1767C20.6775 3.35876 22.0089 3.93941 23.1034 4.85067C23.0427 4.88379 22.937 4.94215 22.8668 4.98473L14.9024 9.58517C14.7025 9.69878 14.5366 9.86356 14.4215 10.0626C14.3065 10.2616 14.2466 10.4877 14.2479 10.7175L14.2424 21.9419ZM16.071 17.9991L20.4018 15.4978L24.7325 17.9975V22.9985L20.4018 25.4983L16.071 22.9985V17.9991Z" fill="currentColor"></path></svg></div></div><div class="relative lg:w-[calc(100%-115px)] w-full flex flex-col"><div class="min-h-[20px] whitespace-pre-wrap flex flex-col items-start gap-4"><div class="request-:R2d6:-12 markdown prose dark:prose-invert break-words dark"><p>Proteins
are complex molecules that are essential for the structure and function
of all living organisms. They play a variety of roles in the body,
including:</p><ul><li><p>Providing structural support: Proteins are the
main component of cells, tissues, and organs, and they provide the
structural framework that gives cells their shape and support.</p></li><li><p>Catalyzing
chemical reactions: Many proteins, called enzymes, act as catalysts
that speed up chemical reactions in the body. Enzymes are involved in
virtually all of the metabolic processes in the body, from breaking down
food molecules to synthesizing hormones and other important molecules.</p></li><li><p>Transporting
molecules: Proteins called carrier proteins and transporter proteins
are responsible for moving molecules across cell membranes and within
the body. For example, hemoglobin is a protein that carries oxygen in
the blood.</p></li><li><p>Regulating biological processes: Proteins
called hormones and neurotransmitters are involved in the regulation of
many important biological processes, such as metabolism, growth, and
development.</p></li><li><p>Providing immunity: Proteins called
antibodies are produced by the immune system to recognize and neutralize
foreign invaders, such as bacteria and viruses.</p></li><li><p>Providing energy: Proteins can be broken down into their component amino acids and used by the body as a source of energy.</p></li></ul><p>Overall,
proteins play a vital role in the structure and function of all living
organisms. They are essential for many of the processes that keep our
bodies functioning properly.</p></div></div><div class="text-gray-400 flex self-end lg:self-center justify-center mt-2 gap-4 lg:gap-1 lg:absolute lg:top-0 lg:translate-x-full lg:right-0 lg:mt-0 lg:pl-2"><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M14 9V5a3 3 0 0 0-3-3l-4 9v11h11.28a2 2 0 0 0 2-1.7l1.38-9a2 2 0 0 0-2-2.3zM7 22H4a2 2 0 0 1-2-2v-7a2 2 0 0 1 2-2h3"></path></svg></button><button class="p-1 rounded-md hover:bg-gray-100 hover:text-gray-700 dark:text-gray-400 dark:hover:bg-gray-700 dark:hover:text-gray-200 disabled:dark:hover:text-gray-400"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M10 15v4a3 3 0 0 0 3 3l4-9V2H5.72a2 2 0 0 0-2 1.7l-1.38 9a2 2 0 0 0 2 2.3zm7-13h2.67A2.31 2.31 0 0 1 22 4v7a2.31 2.31 0 0 1-2.33 2H17"></path></svg></button></div></div></div></div><div class="w-full h-48 flex-shrink-0"></div></div></div></div></div><div class="absolute bottom-0 left-0 w-full dark:border-transparent bg-vert-light-gradient dark:bg-vert-dark-gradient"><form class="flex flex-row stretch gap-3 mx-2 lg:mx-auto pt-2 lg:pt-6 lg:max-w-3xl last:mb-2 md:last:mb-6"><div class="relative flex-1 h-full flex flex-col"><div class="w-full flex gap-2 justify-center mb-3"><button class="btn flex gap-2 justify-center btn-neutral"><svg stroke="currentColor" fill="none" stroke-width="1.5" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-3 h-3" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><polyline points="1 4 1 10 7 10"></polyline><polyline points="23 20 23 14 17 14"></polyline><path d="M20.49 9A9 9 0 0 0 5.64 5.64L1 10m22 4l-4.64 4.36A9 9 0 0 1 3.51 15"></path></svg>Try again</button></div><div class="flex flex-col w-full py-2 pl-3 md:py-3 md:pl-4 relative )} border border-black/10 bg-white dark:border-gray-900/50 dark:text-white dark:bg-gray-700 rounded-md shadow-[0_0_10px_rgba(0,0,0,0.10)] dark:shadow-[0_0_15px_rgba(0,0,0,0.10)]"><textarea tabindex="0" data-id="request-:R2d6:-12" style="max-height: 200px; height: 24px; overflow-y: hidden;" rows="1" placeholder="" class="w-full resize-none focus:ring-0 focus-visible:ring-0 p-0 pr-7 m-0 border-0 bg-transparent dark:bg-transparent"></textarea><button class="absolute p-1 rounded-md text-gray-500 bottom-1.5 right-1 md:bottom-2.5 md:right-2 hover:bg-gray-100 dark:hover:text-gray-400 dark:hover:bg-gray-900 disabled:hover:bg-transparent dark:disabled:hover:bg-transparent"><svg stroke="currentColor" fill="currentColor" stroke-width="0" viewBox="0 0 20 20" class="w-4 h-4 rotate-90" height="1em" width="1em" xmlns="http://www.w3.org/2000/svg"><path d="M10.894 2.553a1 1 0 00-1.788 0l-7 14a1 1 0 001.169 1.409l5-1.429A1 1 0 009 15.571V11a1 1 0 112 0v4.571a1 1 0 00.725.962l5 1.428a1 1 0 001.17-1.408l-7-14z"></path></svg></button></div></div></form><div class="text-xs text-black/50 dark:text-white/50 pt-2 pb-3 px-3 md:pt-3 md:pb-6 md:px-4 text-center">Free
Research Preview: ChatGPT is optimized for dialogue. Our goal is to
make AI systems more natural to interact with, and your feedback will
help us improve our systems and make them safer.</div></div></body></html>
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment