reverse_compliment.py

#Python Problem 1
#reverseComplement.py
#Introduction to Bioinformatics Assignment 2
#Purpose:  reverse compliment
#Your Name: Aram Comjean
#Date: 10/11/2105

#s1 is the string you should use to generate a reverse complement sequence
#Note that your result needs to be presented in the 5' to 3' direction

s1 = "AAAAACCCCCTCGGCTAATCGACTACTACTACTACTACTTCATCATCATCAGGGGGGGGCTCTCTCTAAAAACCCCTTTTGGGGG"

find_replace_dictionary = {'A':'T', 'T':'A','G':'C','C':'G'};

compliment ='';
for key in s1:  
    
    #Skip values if not in dictionary
    if key in find_replace_dictionary:
        
        #add to compliment string
        compliment+= find_replace_dictionary[key]
   
#reverse the string   
reverse_compliment = compliment[::-1]

print reverse_compliment