Created
November 14, 2013 02:49
-
-
Save BenLangmead/7460513 to your computer and use it in GitHub Desktop.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| { | |
| "metadata": { | |
| "name": "" | |
| }, | |
| "nbformat": 3, | |
| "nbformat_minor": 0, | |
| "worksheets": [ | |
| { | |
| "cells": [ | |
| { | |
| "cell_type": "code", | |
| "collapsed": false, | |
| "input": [ | |
| "import math\n", | |
| "import numpy\n", | |
| "\n", | |
| "class HMM(object):\n", | |
| " ''' Simple Hidden Markov Model implementation. User provides\n", | |
| " transition, emission and initial probabilities in dictionaries\n", | |
| " mapping 2-character codes onto floating-point probabilities\n", | |
| " for those table entries. States and emissions are represented\n", | |
| " with single characters. Emission symbols comes from a finite. '''\n", | |
| " \n", | |
| " def __init__(self, A, E, I):\n", | |
| " ''' Initialize the HMM given transition, emission and initial\n", | |
| " probability tables. '''\n", | |
| " \n", | |
| " # put state labels to the set self.Q\n", | |
| " self.Q, self.S = set(), set() # states and symbols\n", | |
| " for a, prob in A.iteritems():\n", | |
| " asrc, adst = a[0], a[1]\n", | |
| " self.Q.add(asrc)\n", | |
| " self.Q.add(adst)\n", | |
| " # add all the symbols to the set self.S\n", | |
| " for e, prob in E.iteritems():\n", | |
| " eq, es = e[0], e[1]\n", | |
| " self.Q.add(eq)\n", | |
| " self.S.add(es)\n", | |
| " \n", | |
| " self.Q = sorted(list(self.Q))\n", | |
| " self.S = sorted(list(self.S))\n", | |
| " \n", | |
| " # create maps from state labels / emission symbols to integers\n", | |
| " # that function as unique IDs\n", | |
| " qmap, smap = {}, {}\n", | |
| " for i in xrange(len(self.Q)): qmap[self.Q[i]] = i\n", | |
| " for i in xrange(len(self.S)): smap[self.S[i]] = i\n", | |
| " lenq = len(self.Q)\n", | |
| " \n", | |
| " # create and populate transition probability matrix\n", | |
| " self.A = numpy.zeros(shape=(lenq, lenq), dtype=float)\n", | |
| " for a, prob in A.iteritems():\n", | |
| " asrc, adst = a[0], a[1]\n", | |
| " self.A[qmap[asrc], qmap[adst]] = prob\n", | |
| " # make A stochastic (i.e. make rows add to 1)\n", | |
| " self.A /= self.A.sum(axis=1)[:, numpy.newaxis]\n", | |
| " \n", | |
| " # create and populate emission probability matrix\n", | |
| " self.E = numpy.zeros(shape=(lenq, len(self.S)), dtype=float)\n", | |
| " for e, prob in E.iteritems():\n", | |
| " eq, es = e[0], e[1]\n", | |
| " self.E[qmap[eq], smap[es]] = prob\n", | |
| " # make E stochastic (i.e. make rows add to 1)\n", | |
| " self.E /= self.E.sum(axis=1)[:, numpy.newaxis]\n", | |
| " \n", | |
| " # initial probabilities\n", | |
| " self.I = [ 0.0 ] * len(self.Q)\n", | |
| " for a, prob in I.iteritems():\n", | |
| " self.I[qmap[a]] = prob\n", | |
| " # make I stochastic (i.e. adds to 1)\n", | |
| " self.I = numpy.divide(self.I, sum(self.I))\n", | |
| " \n", | |
| " self.qmap, self.smap = qmap, smap\n", | |
| " \n", | |
| " # Make log-base-2 versions for log-space functions\n", | |
| " self.Alog = numpy.log2(self.A)\n", | |
| " self.Elog = numpy.log2(self.E)\n", | |
| " self.Ilog = numpy.log2(self.I)\n", | |
| " \n", | |
| " def jointProb(self, p, x):\n", | |
| " ''' Return joint probability of path p and emission string x '''\n", | |
| " p = map(self.qmap.get, p) # turn state characters into ids\n", | |
| " x = map(self.smap.get, x) # turn emission characters into ids\n", | |
| " tot = self.I[p[0]] # start with initial probability\n", | |
| " for i in xrange(1, len(p)):\n", | |
| " tot *= self.A[p[i-1], p[i]] # transition probability\n", | |
| " for i in xrange(0, len(p)):\n", | |
| " tot *= self.E[p[i], x[i]] # emission probability\n", | |
| " return tot\n", | |
| " \n", | |
| " def jointProbL(self, p, x):\n", | |
| " ''' Return log2 of joint probability of path p and emission\n", | |
| " string x. Just like self.jointProb(...) but log2 domain. '''\n", | |
| " p = map(self.qmap.get, p) # turn state characters into ids\n", | |
| " x = map(self.smap.get, x) # turn emission characters into ids\n", | |
| " tot = self.Ilog[p[0]] # start with initial probability\n", | |
| " for i in xrange(1, len(p)):\n", | |
| " tot += self.Alog[p[i-1], p[i]] # transition probability\n", | |
| " for i in xrange(0, len(p)):\n", | |
| " tot += self.Elog[p[i], x[i]] # emission probability\n", | |
| " return tot\n", | |
| " \n", | |
| " def viterbi(self, x):\n", | |
| " ''' Given sequence of emissions, return the most probable path\n", | |
| " along with its probability. '''\n", | |
| " x = map(self.smap.get, x) # turn emission characters into ids\n", | |
| " nrow, ncol = len(self.Q), len(x)\n", | |
| " mat = numpy.zeros(shape=(nrow, ncol), dtype=float) # prob\n", | |
| " matTb = numpy.zeros(shape=(nrow, ncol), dtype=int) # backtrace\n", | |
| " # Fill in first column\n", | |
| " for i in xrange(0, nrow):\n", | |
| " mat[i, 0] = self.E[i, x[0]] * self.I[i]\n", | |
| " # Fill in rest of prob and Tb tables\n", | |
| " for j in xrange(1, ncol):\n", | |
| " for i in xrange(0, nrow):\n", | |
| " ep = self.E[i, x[j]]\n", | |
| " mx, mxi = mat[0, j-1] * self.A[0, i] * ep, 0\n", | |
| " for i2 in xrange(1, nrow):\n", | |
| " pr = mat[i2, j-1] * self.A[i2, i] * ep\n", | |
| " if pr > mx:\n", | |
| " mx, mxi = pr, i2\n", | |
| " mat[i, j], matTb[i, j] = mx, mxi\n", | |
| " # Find final state with maximal probability\n", | |
| " omx, omxi = mat[0, ncol-1], 0\n", | |
| " for i in xrange(1, nrow):\n", | |
| " if mat[i, ncol-1] > omx:\n", | |
| " omx, omxi = mat[i, ncol-1], i\n", | |
| " # Backtrace\n", | |
| " i, p = omxi, [omxi]\n", | |
| " for j in xrange(ncol-1, 0, -1):\n", | |
| " i = matTb[i, j]\n", | |
| " p.append(i)\n", | |
| " p = ''.join(map(lambda x: self.Q[x], p[::-1]))\n", | |
| " return omx, p # Return probability and path\n", | |
| " \n", | |
| " def viterbiL(self, x):\n", | |
| " ''' Given sequence of emissions, return the most probable path\n", | |
| " along with log2 of its probability. Just like viterbi(...)\n", | |
| " but in log2 domain. '''\n", | |
| " x = map(self.smap.get, x) # turn emission characters into ids\n", | |
| " nrow, ncol = len(self.Q), len(x)\n", | |
| " mat = numpy.zeros(shape=(nrow, ncol), dtype=float) # prob\n", | |
| " matTb = numpy.zeros(shape=(nrow, ncol), dtype=int) # backtrace\n", | |
| " # Fill in first column\n", | |
| " for i in xrange(0, nrow):\n", | |
| " mat[i, 0] = self.Elog[i, x[0]] + self.Ilog[i]\n", | |
| " # Fill in rest of log prob and Tb tables\n", | |
| " for j in xrange(1, ncol):\n", | |
| " for i in xrange(0, nrow):\n", | |
| " ep = self.Elog[i, x[j]]\n", | |
| " mx, mxi = mat[0, j-1] + self.Alog[0, i] + ep, 0\n", | |
| " for i2 in xrange(1, nrow):\n", | |
| " pr = mat[i2, j-1] + self.Alog[i2, i] + ep\n", | |
| " if pr > mx:\n", | |
| " mx, mxi = pr, i2\n", | |
| " mat[i, j], matTb[i, j] = mx, mxi\n", | |
| " # Find final state with maximal log probability\n", | |
| " omx, omxi = mat[0, ncol-1], 0\n", | |
| " for i in xrange(1, nrow):\n", | |
| " if mat[i, ncol-1] > omx:\n", | |
| " omx, omxi = mat[i, ncol-1], i\n", | |
| " # Backtrace\n", | |
| " i, p = omxi, [omxi]\n", | |
| " for j in xrange(ncol-1, 0, -1):\n", | |
| " i = matTb[i, j]\n", | |
| " p.append(i)\n", | |
| " p = ''.join(map(lambda x: self.Q[x], p[::-1]))\n", | |
| " return omx, p # Return log probability and path" | |
| ], | |
| "language": "python", | |
| "metadata": {}, | |
| "outputs": [], | |
| "prompt_number": 1 | |
| }, | |
| { | |
| "cell_type": "code", | |
| "collapsed": false, | |
| "input": [ | |
| "# We experiment with joint probabilities first\n", | |
| "\n", | |
| "hmm = HMM({\"FF\":0.9, \"FL\":0.1, \"LF\":0.1, \"LL\":0.9}, # transition matrix A\n", | |
| " {\"FH\":0.5, \"FT\":0.5, \"LH\":0.75, \"LT\":0.25}, # emission matrix E\n", | |
| " {\"F\":0.5, \"L\":0.5}) # initial probabilities I\n", | |
| "jprob1 = hmm.jointProb(\"FFFLLLFFFFF\", \"THTHHHTHTTH\")\n", | |
| "myprob1 = (0.5 ** 9) * (0.75 ** 3) * (0.9 ** 8) * (0.1 ** 2)\n", | |
| "jprob1, myprob1\n", | |
| "# these should be about equal" | |
| ], | |
| "language": "python", | |
| "metadata": {}, | |
| "outputs": [ | |
| { | |
| "metadata": {}, | |
| "output_type": "pyout", | |
| "prompt_number": 2, | |
| "text": [ | |
| "(3.5469405120849628e-06, 3.5469405120849624e-06)" | |
| ] | |
| } | |
| ], | |
| "prompt_number": 2 | |
| }, | |
| { | |
| "cell_type": "code", | |
| "collapsed": false, | |
| "input": [ | |
| "# confirming that log version of jointProb works as expected\n", | |
| "jprobL1 = hmm.jointProbL(\"FFFLLLFFFFF\", \"THTHHHTHTTH\")\n", | |
| "math.log(jprob1, 2), jprobL1" | |
| ], | |
| "language": "python", | |
| "metadata": {}, | |
| "outputs": [ | |
| { | |
| "metadata": {}, | |
| "output_type": "pyout", | |
| "prompt_number": 3, | |
| "text": [ | |
| "(-18.104993435171657, -18.104993435171654)" | |
| ] | |
| } | |
| ], | |
| "prompt_number": 3 | |
| }, | |
| { | |
| "cell_type": "code", | |
| "collapsed": false, | |
| "input": [ | |
| "# Trying another path\n", | |
| "jprob2 = hmm.jointProb(\"FFFFFFFFFFF\", \"THTHHHTHTTH\")\n", | |
| "myprob2 = (0.5 ** 12) * (0.9 ** 10)\n", | |
| "jprob2, myprob2\n", | |
| "# these should be about equal" | |
| ], | |
| "language": "python", | |
| "metadata": {}, | |
| "outputs": [ | |
| { | |
| "metadata": {}, | |
| "output_type": "pyout", | |
| "prompt_number": 4, | |
| "text": [ | |
| "(8.51265722900391e-05, 8.512657229003909e-05)" | |
| ] | |
| } | |
| ], | |
| "prompt_number": 4 | |
| }, | |
| { | |
| "cell_type": "code", | |
| "collapsed": false, | |
| "input": [ | |
| "# Note that jprob2 is greater than jprob1\n", | |
| "\n", | |
| "# Now we experiment with viterbi decoding\n", | |
| "jprobOpt, path = hmm.viterbi(\"THTHHHTHTTH\")\n", | |
| "path" | |
| ], | |
| "language": "python", | |
| "metadata": {}, | |
| "outputs": [ | |
| { | |
| "metadata": {}, | |
| "output_type": "pyout", | |
| "prompt_number": 5, | |
| "text": [ | |
| "'FFFFFFFFFFF'" | |
| ] | |
| } | |
| ], | |
| "prompt_number": 5 | |
| }, | |
| { | |
| "cell_type": "code", | |
| "collapsed": false, | |
| "input": [ | |
| "# maximum likelihood path is same path (all fair) as the second one\n", | |
| "# we tried above, so jprobOpt should equal jprob2\n", | |
| "jprobOpt, jprob2" | |
| ], | |
| "language": "python", | |
| "metadata": {}, | |
| "outputs": [ | |
| { | |
| "metadata": {}, | |
| "output_type": "pyout", | |
| "prompt_number": 6, | |
| "text": [ | |
| "(8.51265722900391e-05, 8.51265722900391e-05)" | |
| ] | |
| } | |
| ], | |
| "prompt_number": 6 | |
| }, | |
| { | |
| "cell_type": "code", | |
| "collapsed": false, | |
| "input": [ | |
| "# confirming that log version of viterbi works as expected\n", | |
| "jprobLOpt, _ = hmm.viterbiL(\"THTHHHTHTTH\")\n", | |
| "math.log(jprobOpt, 2), jprobLOpt" | |
| ], | |
| "language": "python", | |
| "metadata": {}, | |
| "outputs": [ | |
| { | |
| "metadata": {}, | |
| "output_type": "pyout", | |
| "prompt_number": 7, | |
| "text": [ | |
| "(-13.520030934450498, -13.520030934450496)" | |
| ] | |
| } | |
| ], | |
| "prompt_number": 7 | |
| }, | |
| { | |
| "cell_type": "code", | |
| "collapsed": false, | |
| "input": [ | |
| "# Now let's make a new HMM with the same states but where jumps\n", | |
| "# between fair (F) and loaded (L) are much more probable\n", | |
| "hmm = HMM({\"FF\":0.6, \"FL\":0.4, \"LF\":0.4, \"LL\":0.6}, # transition matrix A\n", | |
| " {\"FH\":0.5, \"FT\":0.5, \"LH\":0.8, \"LT\":0.2}, # emission matrix E\n", | |
| " {\"F\":0.5, \"L\":0.5}) # initial probabilities I\n", | |
| "hmm.viterbi(\"THTHHHTHTTH\")" | |
| ], | |
| "language": "python", | |
| "metadata": {}, | |
| "outputs": [ | |
| { | |
| "metadata": {}, | |
| "output_type": "pyout", | |
| "prompt_number": 8, | |
| "text": [ | |
| "(2.8665446400000001e-06, 'FFFLLLFFFFL')" | |
| ] | |
| } | |
| ], | |
| "prompt_number": 8 | |
| }, | |
| { | |
| "cell_type": "code", | |
| "collapsed": false, | |
| "input": [ | |
| "# Here's an example of underflow. Note that probability returned\n", | |
| "# is 0.0 and the state string becomes all Fs after a while.\n", | |
| "hmm.viterbi(\"THTHHHTHTTH\" * 100)" | |
| ], | |
| "language": "python", | |
| "metadata": {}, | |
| "outputs": [ | |
| { | |
| "metadata": {}, | |
| "output_type": "pyout", | |
| "prompt_number": 9, | |
| "text": [ | |
| "(0.0,\n", | |
| " 'FFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF')" | |
| ] | |
| } | |
| ], | |
| "prompt_number": 9 | |
| }, | |
| { | |
| "cell_type": "code", | |
| "collapsed": false, | |
| "input": [ | |
| "# Moving to log2 domain fixes underflow\n", | |
| "hmm.viterbiL(\"THTHHHTHTTH\" * 100)" | |
| ], | |
| "language": "python", | |
| "metadata": {}, | |
| "outputs": [ | |
| { | |
| "metadata": {}, | |
| "output_type": "pyout", | |
| "prompt_number": 10, | |
| "text": [ | |
| "(-1824.4030071946879,\n", | |
| " 'FFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFFFFFLLLFFFFL')" | |
| ] | |
| } | |
| ], | |
| "prompt_number": 10 | |
| }, | |
| { | |
| "cell_type": "code", | |
| "collapsed": false, | |
| "input": [ | |
| "cpgHmm = HMM({'IO':0.20, 'OI':0.20, 'II':0.80, 'OO':0.80},\n", | |
| " {'IA':0.10, 'IC':0.40, 'IG':0.40, 'IT':0.10,\n", | |
| " 'OA':0.25, 'OC':0.25, 'OG':0.25, 'OT':0.25},\n", | |
| " {'I' :0.50, 'O' :0.50})\n", | |
| "x = 'ATATATACGCGCGCGCGCGCGATATATATATATA'\n", | |
| "logp, path = cpgHmm.viterbiL(x)\n", | |
| "print x\n", | |
| "print path # finds the CpG island fine" | |
| ], | |
| "language": "python", | |
| "metadata": {}, | |
| "outputs": [ | |
| { | |
| "output_type": "stream", | |
| "stream": "stdout", | |
| "text": [ | |
| "ATATATACGCGCGCGCGCGCGATATATATATATA\n", | |
| "OOOOOOOIIIIIIIIIIIIIIOOOOOOOOOOOOO\n" | |
| ] | |
| } | |
| ], | |
| "prompt_number": 11 | |
| }, | |
| { | |
| "cell_type": "code", | |
| "collapsed": false, | |
| "input": [ | |
| "x = 'ATATCGCGCGCGATATATCGCGCGCGATATATAT'\n", | |
| "logp, path = cpgHmm.viterbiL(x)\n", | |
| "print x\n", | |
| "print path # finds two CpG islands fine" | |
| ], | |
| "language": "python", | |
| "metadata": {}, | |
| "outputs": [ | |
| { | |
| "output_type": "stream", | |
| "stream": "stdout", | |
| "text": [ | |
| "ATATCGCGCGCGATATATCGCGCGCGATATATAT\n", | |
| "OOOOIIIIIIIIOOOOOOIIIIIIIIOOOOOOOO\n" | |
| ] | |
| } | |
| ], | |
| "prompt_number": 12 | |
| }, | |
| { | |
| "cell_type": "code", | |
| "collapsed": false, | |
| "input": [ | |
| "x = 'ATATATACCCCCCCCCCCCCCATATATATATATA'\n", | |
| "logp, path = cpgHmm.viterbiL(x)\n", | |
| "print x\n", | |
| "print path # oops! - this is just a bunch of Cs. What went wrong?" | |
| ], | |
| "language": "python", | |
| "metadata": {}, | |
| "outputs": [ | |
| { | |
| "output_type": "stream", | |
| "stream": "stdout", | |
| "text": [ | |
| "ATATATACCCCCCCCCCCCCCATATATATATATA\n", | |
| "OOOOOOOIIIIIIIIIIIIIIOOOOOOOOOOOOO\n" | |
| ] | |
| } | |
| ], | |
| "prompt_number": 13 | |
| }, | |
| { | |
| "cell_type": "code", | |
| "collapsed": false, | |
| "input": [], | |
| "language": "python", | |
| "metadata": {}, | |
| "outputs": [], | |
| "prompt_number": 13 | |
| } | |
| ], | |
| "metadata": {} | |
| } | |
| ] | |
| } |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment